AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i114_Glutamine_Transport_ecoli_reg_300.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 glnP 138 glutamine high-affinity transport system; membrane component #2 glnH 300 periplasmic glutamine-binding protein; permease Motif number 1 CCCCGGAGCGGGTTTGCGCCCCTCACCCTA 1 67 0 GGTTTGCGCC 0.916995 -72 TCAGGGTAATTAATGGCCCCGGAGCGGGTT 1 83 0 TAATGGCCCC 0.890605 -56 TGGTGCGCTAAAATTGTGCACTCAACACAG 2 115 0 AAATTGTGCA 0.946845 -186 TAGCGCACCAGATTGGTGCCCCAGAATGGT 2 135 1 GATTGGTGCC 0.987282 -166 TGGTGCCCCAGAATGGTGCATCTTCAGGGT 2 148 1 GAATGGTGCA 0.98808 -153 ATTGCCCTATAAATCGTGCATCACGTTTTT 2 178 1 AAATCGTGCA 0.97569 -123 ATATATGAAAAAATCGTGCCAGTTTTGCAA 2 232 0 AAATCGTGCC 0.990354 -69 GTCACGCAGGGGATCGTCCCGTGGATAGAA 2 268 1 GGATCGTCCC 0.97668 -33 ********** Masking position 4 Map Score: 10.3102 Number of sites scoring better than the average of aligned sites = 792 Number in coding regions = 724 Number in noncoding regions = 68 Number of orfs with sites within 600 bp upstream = 68 Fraction of orfs with sites within 600 bp upstream = 0.0109219 Motif number 2 TCTCCCCATAGGGGAGAGGGAACTGCCAGT 1 33 0 GGGGAGAGGG 0.989006 -106 TCTCCCCTATGGGGAGAGGATTAGGGTGAG 1 46 1 GGGGAGAGGA 0.970572 -93 GGAGAGGATTAGGGTGAGGGGCGCAAACCC 1 58 1 AGGGTGAGGG 0.990354 -81 GTGCATCTTCAGGGTATTGCCCTATAAATC 2 163 1 AGGGTATTGC 0.950748 -138 ATGCGGCAAAAACGTGATGCACGATTTATA 2 185 0 AACGTGATGC 0.938045 -116 TCGAAAAATCAAGGAGTTGCAAAACTGGCA 2 216 1 AAGGAGTTGC 0.978076 -85 GGATAGAAAAAAGGAAATGCT 2 290 1 AAGGAAATGC 0.965488 -11 ********** Masking position 4 Map Score: 5.79917 Number of sites scoring better than the average of aligned sites = 941 Number in coding regions = 759 Number in noncoding regions = 182 Number of orfs with sites within 600 bp upstream = 148 Fraction of orfs with sites within 600 bp upstream = 0.0237713 Motif number 3 TGATGATGTGGATACAAAAAATTTACTTAA 2 32 0 GATACAAAAA 0.983322 -269 TCACACAATCGTTACATAAAGATTGTTTTT 2 59 1 GTTACATAAA 0.867308 -242 CGTAAAACCTGATGAAAAAACAATCTTTAT 2 74 0 GATGAAAAAA 0.976276 -227 TTTTCGAGATGCGGCAAAAACGTGATGCAC 2 193 0 GCGGCAAAAA 0.944075 -108 AAATCAAGGAGTTGCAAAACTGGCACGATT 2 221 1 GTTGCAAAAC 0.952489 -80 CATTCACATATATGAAAAAATCGTGCCAGT 2 239 0 TATGAAAAAA 0.842214 -62 TCGTCCCGTGGATAGAAAAAAGGAAATGCT 2 281 1 GATAGAAAAA 0.94365 -20 ********** Masking position 6 Map Score: 4.30448 Number of sites scoring better than the average of aligned sites = 1227 Number in coding regions = 1067 Number in noncoding regions = 160 Number of orfs with sites within 600 bp upstream = 182 Fraction of orfs with sites within 600 bp upstream = 0.0292323 Motif number 4 ACCCTGAATTTGATTATTTACACCACGGTA 1 106 1 TGATTATTTA 0.929252 -33 TATCTCCAGCTGATTAAGTAAATTTTTTGT 2 19 1 TGATTAAGTA 0.889635 -282 AACGATTGTGTGATGATGTGGATACAAAAA 2 42 0 TGATGATGTG 0.951461 -259 ACATAAAGATTGTTTTTTCATCAGGTTTTA 2 72 1 TGTTTTTTCA 0.790211 -229 CTCAACACAGTGATTATTTAGCGTAAAACC 2 95 0 TGATTATTTA 0.929252 -206 GGCAATACCCTGAAGATGCACCATTCTGGG 2 154 0 TGAAGATGCA 0.858085 -147 TGCAACTCCTTGATTTTTCGAGATGCGGCA 2 207 0 TGATTTTTCG 0.922627 -94 ********** Masking position 1 Map Score: 3.48464 Number of sites scoring better than the average of aligned sites = 726 Number in coding regions = 606 Number in noncoding regions = 120 Number of orfs with sites within 600 bp upstream = 141 Fraction of orfs with sites within 600 bp upstream = 0.022647 Motif number 5 GCAAACCCGCTCCGGGGCCATTAATTACCC 1 80 1 TCCGGGGCCA 0.927625 -59 AATAATCAAATTCAGGGTAATTAATGGCCC 1 94 0 TTCAGGGTAA 0.953198 -45 ACAGTGATTATTTAGCGTAAAACCTGATGA 2 89 0 TTTAGCGTAA 0.927577 -212 AATCACTGTGTTGAGTGCACAATTTTAGCG 2 110 1 TTGAGTGCAC 0.903707 -191 AGTGCACAATTTTAGCGCACCAGATTGGTG 2 123 1 TTTAGCGCAC 0.982663 -178 GATGCACCATTCTGGGGCACCAATCTGGTG 2 140 0 TCTGGGGCAC 0.983786 -161 ATGCACGATTTATAGGGCAATACCCTGAAG 2 169 0 TATAGGGCAA 0.964756 -132 ********** Masking position 1 Map Score: 3.48954 Number of sites scoring better than the average of aligned sites = 681 Number in coding regions = 601 Number in noncoding regions = 80 Number of orfs with sites within 600 bp upstream = 88 Fraction of orfs with sites within 600 bp upstream = 0.0141343 Motif number 6 GTGCGTTTTACAGGTGTAGCGTTA 1 5 0 CAGGTGTAGC 0.906281 -134 GGATTAGGGTGAGGGGCGCAAACCCGCTCC 1 63 1 GAGGGGCGCA 0.964926 -76 GGGCACCAATCTGGTGCGCTAAAATTGTGC 2 126 0 CTGGTGCGCT 0.969134 -175 ATGCACCATTCTGGGGCACCAATCTGGTGC 2 139 0 CTGGGGCACC 0.989166 -162 CAATACCCTGAAGATGCACCATTCTGGGGC 2 152 0 AAGATGCACC 0.955617 -149 CGGCAAAAACGTGATGCACGATTTATAGGG 2 182 0 GTGATGCACG 0.949131 -119 TTGATTTTTCGAGATGCGGCAAAAACGTGA 2 198 0 GAGATGCGGC 0.977573 -103 ********** Masking position 6 Map Score: 3.02549 Number of sites scoring better than the average of aligned sites = 2288 Number in coding regions = 2170 Number in noncoding regions = 118 Number of orfs with sites within 600 bp upstream = 98 Fraction of orfs with sites within 600 bp upstream = 0.0157404 Motif number 7 ********** No masking Map Score: 7.2008e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 7.2008e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 7.2008e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0