AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i116_Peptide_Transport_ecoli_reg_100.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 sapA 248 homolog of Salmonella peptide transport periplasmic protein Motif number 1 GTGACGTCGCCATCTGTTCAACATTCGTAC 1 116 0 CATCTGTTCA 0.989618 -133 ATGGCGACGTCACCTGTTCAACGACCAACC 1 133 1 CACCTGTTCA 0.990375 -116 ACCACACGGCCCTCATTACGACCCCTGAAC 1 160 1 CCTCATTACG 0.949141 -89 CTCATTACGACCCCTGAACACAAACGGTAA 1 171 1 CCCCTGAACA 0.990194 -78 AGTAAGATAGCCTCTTTACATAAAATCCCT 1 222 1 CCTCTTTACA 0.992731 -27 ********** Masking position 4 Map Score: 5.21437 Number of sites scoring better than the average of aligned sites = 235 Number in coding regions = 206 Number in noncoding regions = 29 Number of orfs with sites within 600 bp upstream = 32 Fraction of orfs with sites within 600 bp upstream = 0.00513974 Motif number 2 TAACAATGACACGCACTGCAGCGTGCTT 1 9 1 ACACGCACTG 0.980754 -240 AGAAACCCATTAAAGCACGCTGCAGTGCGT 1 21 0 TAAAGCACGC 0.921585 -228 CTCACGATCGTACCGCTCTGCTCCTCGCTA 1 49 1 TACCGCTCTG 0.913641 -200 TCTATAACTATAACTCACAGAACAACTTAG 1 76 0 TAACTCACAG 0.950154 -173 TAGTTATAGAGAAATCACGGGTACGAATGT 1 96 1 GAAATCACGG 0.940889 -153 TTCAACGACCAACCACACGGCCCTCATTAC 1 149 1 AACCACACGG 0.985281 -100 CGACCCCTGAACACAAACGGTAATGGCAAA 1 178 1 ACACAAACGG 0.896721 -71 ********** Masking position 8 Map Score: 1.8139 Number of sites scoring better than the average of aligned sites = 2782 Number in coding regions = 2622 Number in noncoding regions = 160 Number of orfs with sites within 600 bp upstream = 192 Fraction of orfs with sites within 600 bp upstream = 0.0308384 Motif number 3 GGAGCAGAGCGGTACGATCGTGAGAAACCC 1 43 0 GGTACGATCG 0.996092 -206 AGAAATCACGGGTACGAATGTTGAACAGAT 1 105 1 GGTACGAATG 0.99133 -144 ATTAAATATTAGTAAGATAGCCTCTTTACA 1 212 1 AGTAAGATAG 0.966331 -37 ********** Masking position 4 Map Score: 0.369612 Number of sites scoring better than the average of aligned sites = 61 Number in coding regions = 57 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 4 ********** No masking Map Score: -4.23894e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -4.23894e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -4.23894e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0