AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i131_Transmembrane_Transport_5_ecoli_reg_100.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 ybiH 216 putative transcriptional regulator Motif number 1 CGGGGCGGTTCGGAGTAGTT 1 1 0 CGGAGTAGTT 0.99592 -216 CGGTAACGGTCGGGGCGGTTCGGAGTAGTT 1 11 0 CGGGGCGGTT 0.997049 -206 CGACCGTTACCGGTGTAGTTTTCAGGGAGA 1 29 1 CGGTGTAGTT 0.995919 -188 TCCCTCATGACATTGTGGTTTTTGTCATTT 1 71 0 CATTGTGGTT 0.958513 -146 GGGAGCGGAGTGTAGCAGTTTTTGTGACGC 1 97 1 TGTAGCAGTT 0.967829 -120 TATGACTCCATAGGGGAGTTGTCCAGTATG 1 172 0 TAGGGGAGTT 0.961957 -45 ********** Masking position 9 Map Score: 8.16535 Number of sites scoring better than the average of aligned sites = 813 Number in coding regions = 746 Number in noncoding regions = 67 Number of orfs with sites within 600 bp upstream = 62 Fraction of orfs with sites within 600 bp upstream = 0.00995824 Motif number 2 GAAAAGGAAAATGACAAAAACCACAATGTC 1 63 1 ATGACAAAAA 0.935247 -154 GTTGTCCAGTATGGCTAAGAATTTTAGCAA 1 155 0 ATGGCTAAGA 0.988379 -62 AATCAAATGATTGATTAAGATTATGACTCC 1 193 0 TTGATTAAGA 0.989443 -24 AATCAATCATTTGATTAAGA 1 207 1 TTGATTAAGA 0.989443 -10 ********** Masking position 7 Map Score: 3.22795 Number of sites scoring better than the average of aligned sites = 59 Number in coding regions = 44 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 3 ACCGGTAACGGTCGGGGCGGTTCGGAGTAG 1 13 0 GTCGGGGCGG 0.998118 -204 ACAATGTCATGAGGGAGCGGAGTGTAGCAG 1 85 1 GAGGGAGCGG 0.998345 -132 CAGTTTTTGTGACGCAGCGCATAAATTATC 1 112 1 GACGCAGCGC 0.996929 -105 ********** Masking position 4 Map Score: 2.3034 Number of sites scoring better than the average of aligned sites = 150 Number in coding regions = 143 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 4 AACGGTCGGGGCGGTTCGGAGTAGTT 1 7 0 GCGGTTCGGA 0.937678 -210 AGTTTTCAGGGAGATACTGAAAAGGAAAAT 1 45 1 GAGATACTGA 0.957795 -172 GCTCCCTCATGACATTGTGGTTTTTGTCAT 1 73 0 GACATTGTGG 0.973401 -144 AGCAACGCCAGTCACAGGGATAATTTATGC 1 130 0 GTCACAGGGA 0.934014 -87 AAAATTCTTAGCCATACTGGACAACTCCCC 1 160 1 GCCATACTGG 0.993025 -57 AGATTATGACTCCATAGGGGAGTTGTCCAG 1 176 0 TCCATAGGGG 0.955629 -41 ********** Masking position 9 Map Score: 1.82942 Number of sites scoring better than the average of aligned sites = 1972 Number in coding regions = 1850 Number in noncoding regions = 122 Number of orfs with sites within 600 bp upstream = 123 Fraction of orfs with sites within 600 bp upstream = 0.0197559 Motif number 5 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0