AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i135_Transmembrane_Transport_9_ecoli_reg_100.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 tolB 132 periplasmic protein involved in the tonb-independent uptake of group A colicins #2 pal 34 peptidoglycan-associated lipoprotein Motif number 1 TCGCGATGTTGACTGTTCGGACGGT 1 6 1 ATGTTGACTG 0.994504 -127 CCGGTGCCTGATGTTGACCGTCCGAACAGT 1 22 0 ATGTTGACCG 0.996622 -111 ATTTAGCAGAATGTTAACAAACTAAAATAC 1 78 0 ATGTTAACAA 0.766076 -55 TATCTCCCTTATCTGGACCGATGGCCCACG 1 111 0 ATCTGGACCG 0.994367 -22 ********** Masking position 4 Map Score: 5.42421 Number of sites scoring better than the average of aligned sites = 290 Number in coding regions = 270 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 2 GTCAACATCAGGCACCGGTTGCCACGGGGT 1 34 1 GGCACCGGTT 0.997994 -99 GGCACCGGTTGCCACGGGGTTCTGGTAGTT 1 44 1 GCCACGGGGT 0.897209 -89 ATTATCGTGGGCCATCGGTCCAGATAAGGG 1 106 1 GCCATCGGTC 0.994206 -27 ********** Masking position 4 Map Score: 2.53125 Number of sites scoring better than the average of aligned sites = 247 Number in coding regions = 239 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 3 CTAAAATACACAAAACTACCAGAACCCCGT 1 57 0 CAAAACTACC 0.991561 -76 TGTTAACAAACTAAAATACACAAAACTACC 1 67 0 CTAAAATACA 0.980919 -66 TAACATTCTGCTAAATTATCGTGGGCCATC 1 92 1 CTAAATTATC 0.980619 -41 ********** Masking position 5 Map Score: 0.215971 Number of sites scoring better than the average of aligned sites = 83 Number in coding regions = 71 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 4 ********** No masking Map Score: -2.10731e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.10731e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.10731e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0