AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i190_ribonucleoside_diphos___ecoli_reg_300.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 nrdA 300 ribonucleoside diphosphate reductase 1, alpha subunit, B1 #2 nrdB 21 ribonucleoside-diphosphate reductase 1, beta subunit, B2 #3 ygaM 139 orf, hypothetical protein #4 nrdH 247 glutaredoxin-like protein; hydrogen donor Motif number 1 AAAAATAACTGTTCGGCGATTTCTTGAACGGCAT 1 33 0 GTCGGTTTCT 0.947425 -268 GTGCATAACTTTGTGGATAACTCAGGAAGGAAAA 1 135 0 TTTGGACTCA 0.87714 -166 TAGGGGGTATGTTTGGGATTCACTGCAAGATAGT 1 190 0 GTTGGTCACT 0.980266 -111 TCGTACCTGTTTTTGGAATTCTTTCCGCAATAGT 1 272 0 TTTGGTCTTT 0.969341 -29 CATCGCGGCTTTATGGACTTTTCTGAAAGCGTTG 3 65 0 TTTGGTTTCT 0.973492 -75 GTTAAGAAAATTATGGTCTACACTGAAAATTACA 3 106 1 TTTGGACACT 0.933793 -34 GAAGCCTGTCTTCGGGGTTTCTTTTTGCCTGGTG 4 46 1 TTGGGTCTTT 0.963071 -202 GCGTGACGGGGTAGGGGGATTTTTGTGATTCACC 4 76 0 GTGGGTTTTT 0.931648 -172 GCTATATATTGTGTGGTTGAATCTTTTTTCAACT 4 140 1 GTTGGAATCT 0.913007 -108 GATGATACGCGTCGGGTTGTCTCTCTGTTGATAC 4 189 0 GTGGGTCTCT 0.993261 -59 ** *** ***** Masking position 2 Map Score: 9.57146 Number of sites scoring better than the average of aligned sites = 335 Number in coding regions = 302 Number in noncoding regions = 33 Number of orfs with sites within 600 bp upstream = 41 Fraction of orfs with sites within 600 bp upstream = 0.00658529 Motif number 2 TCTAACCTATTATGCCGTTCAAGAAATCGCCGAACA 1 22 1 TTGGTCGAAA 0.978599 -279 TTAGGTCAGACAAGGTGTCCGGGAAAGTCAATGGGA 1 82 0 CAGGTCGAAA 0.99665 -219 CCTTGTCTGACCTAAGGTGCGCGAAAGCCACTTTTT 1 103 1 CTAGTCGAAA 0.990102 -198 ATGCAGACTACCTGTAGTACGGGAAGCTGCTTAGAA 1 233 0 CTGGTCGAAG 0.98363 -68 CAATATATAGCAAATAGTGGTCGAAATTACCCTGGA 4 115 0 CAAGTGGAAA 0.981337 -133 TACAGAGATACTAGATGTAGTTGAAAAAAGATTCAA 4 156 0 CAGGTGGAAA 0.99358 -92 * ** ** * **** Masking position 8 Map Score: 4.17546 Number of sites scoring better than the average of aligned sites = 123 Number in coding regions = 107 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 3 AAAAATTTGTTAAAAATAACTGTTCGGCGA 1 48 0 TAAAAATAAC 0.926764 -253 CAAGATAGTGTGAAAATGACCCTCTTGCAA 1 169 0 TGAAAATGAC 0.986166 -132 GGCCCGCGGTTGATAATAACGAGGATCAAA 3 12 0 TGATAATAAC 0.972523 -128 TGGTCTACACTGAAAATTACATCGAATTCT 3 119 1 TGAAAATTAC 0.96314 -21 TGCAAAAATGATAATAAATACGCGTCTT 4 9 1 TGATAATAAA 0.922838 -239 GTATTTCCGTTTAAAATGAAGATACGGCGC 4 223 0 TTAAAATGAA 0.821772 -25 ********** Masking position 5 Map Score: 3.99738 Number of sites scoring better than the average of aligned sites = 224 Number in coding regions = 177 Number in noncoding regions = 47 Number of orfs with sites within 600 bp upstream = 60 Fraction of orfs with sites within 600 bp upstream = 0.00963701 Motif number 4 ATATCAATTTATCTAACCTATTATGCCGTTCA 1 10 1 TTCACCTATT 0.963707 -291 CCGGACACCTTGTCTGACCTAAGGTGCGCGAAA 1 96 1 TTCACCTAAG 0.987326 -205 AAAGCCACTTTTTCCTTCCTGAGTTATCCACAA 1 126 1 TTCTCCTGAG 0.982722 -175 GTATGTCGTACCTGTTTTTGGAATTC 1 285 0 TTCACCTGTT 0.987434 -16 ACCGCGGGCCTACCTTACCTGATTGCGCATTCA 3 32 1 TCCACCTGAT 0.981689 -108 AGACCATAATTTTCTTAACTGAGGTTCATCGCG 3 92 0 TTCAACTGAG 0.972727 -48 * ** ******* Masking position 10 Map Score: 3.27826 Number of sites scoring better than the average of aligned sites = 135 Number in coding regions = 112 Number in noncoding regions = 23 Number of orfs with sites within 600 bp upstream = 27 Fraction of orfs with sites within 600 bp upstream = 0.00433665 Motif number 5 GAAAGTCAATGGGAAGAGAAAAATTTGTTA 1 66 0 GGGAAGAGAA 0.854766 -235 TGAAACTATTGCGGAAAGAATTCCAAAAAC 1 268 1 GCGGAAAGAA 0.949952 -33 GATTCACCAGGCAAAAAGAAACCCCGAAGA 4 54 0 GCAAAAAGAA 0.82387 -194 CTCTGTTGATACAGAGATACTAGATGTAGT 4 171 0 ACAGAGATAC 0.950741 -77 CTCTGTATCAACAGAGAGACAACCCGACGC 4 185 1 ACAGAGAGAC 0.968369 -63 AAGATACGGCGCGATGATACGCGTCGGGTT 4 205 0 GCGATGATAC 0.898463 -43 TCCGTTTAAAATGAAGATACGGCGCGATGA 4 218 0 ATGAAGATAC 0.801503 -30 TTCATTTTAAACGGAAATACGAATC 4 233 1 ACGGAAATAC 0.950741 -15 ********** Masking position 7 Map Score: 1.70283 Number of sites scoring better than the average of aligned sites = 1268 Number in coding regions = 1130 Number in noncoding regions = 138 Number of orfs with sites within 600 bp upstream = 132 Fraction of orfs with sites within 600 bp upstream = 0.0212014 Motif number 6 GCATAACTTTGTGGATAACTCAGGAAGGAA 1 137 0 GTGGATAACT 0.974152 -164 CCTCTTGCAAGTGCATAACTTTGTGGATAA 1 149 0 GTGCATAACT 0.974157 -152 CTATCTTGCAGTGAATCCCAAACATACCCC 1 191 1 GTGAATCCCA 0.975957 -110 TTTTTGCCTGGTGAATCACAAAAATCCCCC 4 67 1 GTGAATCACA 0.985787 -181 ********** Masking position 5 Map Score: 0.501638 Number of sites scoring better than the average of aligned sites = 40 Number in coding regions = 34 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 7 ACAAGGTGTCCGGGAAAGTCAATGGGAAGA 1 79 0 CGGGAAAGTC 0.988108 -222 ACCTAAGGTGCGCGAAAGCCACTTTTTCCT 1 112 1 CGCGAAAGCC 0.981981 -189 GAATTCTTTCCGCAATAGTTTCATGCAGAC 1 261 0 CGCAATAGTT 0.867142 -40 ACAACGCTTTCAGAAAAGTCCATAAAGCCG 3 64 1 CAGAAAAGTC 0.971559 -76 CCTGGTGAATCACAAAAATCCCCCTACCCC 4 73 1 CACAAAAATC 0.905079 -175 ********** Masking position 5 Map Score: 0.33188 Number of sites scoring better than the average of aligned sites = 416 Number in coding regions = 380 Number in noncoding regions = 36 Number of orfs with sites within 600 bp upstream = 47 Fraction of orfs with sites within 600 bp upstream = 0.00754899 Motif number 8 ********** No masking Map Score: 1.10377e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 1.10377e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ********** No masking Map Score: 1.10377e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0