AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i194_dna_replication_ecoli_reg_300.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 ybaN 69 putative gene 58 #2 apt 152 adenine phosphoribosyltransferase #3 dnaX 128 DNA polymerase III, tau and gamma subunits; DNA elongation factor III #4 ybaB 52 orf, hypothetical protein Motif number 1 TGGCTACTTTAGCATAACAATTATCATTTTCATT 1 22 0 AGCATAACAT 0.896497 -48 AGCACAACAATCGCAGTTGCAATT 2 1 1 AGCACAACAC 0.996085 -152 GCAATTATTGCGTACAGCCAGTACATTCTGGCGT 2 29 1 CGTACAGCCC 0.951284 -124 GGCGTTTTCGAGCACAGGCGCAGGCGGTCAAAGG 2 58 1 AGCACAGGCG 0.975474 -95 ACGCGCCGTGAGTACCACCGTAACAAGCAGGCAT 2 123 1 AGTACCACCC 0.952814 -30 TAGCGTGGGCAGCACAAGACTGGCGATAA 3 6 0 AGCACAAGAC 0.99122 -123 CGCTACGGACAGCACAAGATGTGCATTCAGCCTC 3 35 1 AGCACAAGAC 0.99122 -94 GGGTAATGCTAACACAGCCCCGTCAGAACGGCGA 3 67 0 AACACAGCCC 0.979304 -62 GGGCTGTGTTAGCATTACCCCTTCGTGAATCCAC 3 81 1 AGCATTACCC 0.931621 -48 TCGTAAGCACAGCTTACGTTCGTCATCCT 4 6 1 AGCACAGCTT 0.942852 -47 ********* * Masking position 4 Map Score: 11.2692 Number of sites scoring better than the average of aligned sites = 1637 Number in coding regions = 1556 Number in noncoding regions = 81 Number of orfs with sites within 600 bp upstream = 83 Fraction of orfs with sites within 600 bp upstream = 0.0133312 Motif number 2 ATTGAGTGTTGTCAGCTTACAGAGTG 1 54 0 GTGTGTCAGC 0.990079 -16 CAATTATTGCGTACAGCCAGTACATTCTGGC 2 30 1 GTACGCCAGT 0.944861 -123 TCGAGCACAGGCGCAGGCGGTCAAAGGTTAA 2 65 1 GCGCGGCGGT 0.991517 -88 CGTTTAAAACGCGCCGTGAGTACCACCGTAA 2 115 1 GCGCGTGAGT 0.989126 -38 GCTGTCCGTAGCGTGGGCAGCACAAGACTGG 3 17 0 GCGTGGCAGC 0.990648 -112 TGCACATCTTGTGCTGTCCGTAGCGTGGGCA 3 29 0 GTGCGTCCGT 0.991084 -100 AGCACAAGATGTGCATTCAGCCTCGCCGTTC 3 45 1 GTGCTTCAGC 0.979869 -84 TGCTAACACAGCCCCGTCAGAACGGCGAGGC 3 64 0 GCCCGTCAGA 0.97099 -65 **** ****** Masking position 10 Map Score: 10.3796 Number of sites scoring better than the average of aligned sites = 2569 Number in coding regions = 2485 Number in noncoding regions = 84 Number of orfs with sites within 600 bp upstream = 83 Fraction of orfs with sites within 600 bp upstream = 0.0133312 Motif number 3 GTACATTCTGGCGTTTTCGAGCACAGGCGCA 2 49 1 GCGTTTCGAG 0.996291 -104 TACTCACGGCGCGTTTTAAACGTATCAAAAG 2 106 0 GCGTTTAAAC 0.977228 -47 CCACCTTCCAGCGTTTCAGAGCCTGCCA 3 111 1 GCGTTTAGAG 0.997819 -18 CATCCTTAACGTGATTGAGAGAGAAACCT 4 34 1 GTGATTAGAG 0.978545 -19 ****** **** Masking position 6 Map Score: 2.41629 Number of sites scoring better than the average of aligned sites = 67 Number in coding regions = 60 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 4 AATTGTTATGCTAAAGTAGCCACTCTGTAAG 1 34 1 CAAAGTAGCC 0.990578 -36 TTAAACGTATCAAAAGTAACAGTTGTTTAAC 2 91 0 CAAAGTAACA 0.977388 -62 GCCGTGAGTACCACCGTAACAAGCAGGCATA 2 127 1 CACCGTAACA 0.977715 -26 AGGGGTAATGCTAACACAGCCCCGTCAGAAC 3 72 0 CAACACAGCC 0.953376 -57 TTAAGGATGACGAACGTAAGCTGTGCTTACG 4 12 0 CAACGTAAGC 0.984208 -41 * ********* Masking position 8 Map Score: 0.896695 Number of sites scoring better than the average of aligned sites = 451 Number in coding regions = 421 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 37 Fraction of orfs with sites within 600 bp upstream = 0.00594282 Motif number 5 TAAAGTAGCCACTCTGTAAGCTGACAACAC 1 45 1 ACTCTGTAAG 0.959976 -25 TACTGGCTGTACGCAATAATTGCAACTGCG 2 22 0 ACGCAATAAT 0.933319 -131 GTGCTCGAAAACGCCAGAATGTACTGGCTG 2 43 0 ACGCCAGAAT 0.974592 -110 CGTTTAAAACGCGCCGTGAGTACCACCGTA 2 115 1 GCGCCGTGAG 0.975207 -38 AGGCTCTGAAACGCTGGAAGGTGGATTCAC 3 105 0 ACGCTGGAAG 0.992575 -24 ********** Masking position 9 Map Score: 0.95692 Number of sites scoring better than the average of aligned sites = 1539 Number in coding regions = 1473 Number in noncoding regions = 66 Number of orfs with sites within 600 bp upstream = 71 Fraction of orfs with sites within 600 bp upstream = 0.0114038 Motif number 6 ********** No masking Map Score: -2.81785e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -2.81785e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -2.81785e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0