AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i223_Pseudouridylate_Synthase_ecoli_reg_100.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 yciL 210 orf, hypothetical protein #2 yjbC 211 orf, hypothetical protein Motif number 1 AGAACTTACATCTGACTCACTGATAGTAAA 1 130 0 TCTGACTCAC 0.997414 -81 AGATGTAAGTTCTGACTCACTGTTGCACAA 1 147 1 TCTGACTCAC 0.997414 -64 TCCCGTGATTTCTTACTAACCGGAGAAGTA 2 11 0 TCTTACTAAC 0.989179 -201 GAATTTAACCACTTACTGACATGGCTCACG 2 57 1 ACTTACTGAC 0.981692 -155 ********** Masking position 5 Map Score: 5.90407 Number of sites scoring better than the average of aligned sites = 24 Number in coding regions = 19 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 2 ATCTTTATGGTTAAAGCTTGTTTCGATTAA 1 22 0 TTAAAGCTTG 0.847685 -189 CATAAAGATAGTGTAGTATGTTGCGCCTCA 1 43 1 GTGTAGTATG 0.862206 -168 AGTCGTTTACTTAAGGCCTGAAGAGTTCAA 1 94 1 TTAAGGCCTG 0.978572 -117 CTCACTGATAGTAAAGTCTGTTTGAACTCT 1 115 0 GTAAAGTCTG 0.975152 -96 TGAGTCAGATGTAAGTTCTGACTCACTGTT 1 141 1 GTAAGTTCTG 0.926137 -70 AAGAAATCACGGGAGGCATGCTACCACTGC 2 27 1 GGGAGGCATG 0.975345 -185 GTGCGACATCGTGAGCCATGTCAGTAAGTG 2 66 0 GTGAGCCATG 0.96719 -146 ********** Masking position 9 Map Score: 2.58876 Number of sites scoring better than the average of aligned sites = 1055 Number in coding regions = 943 Number in noncoding regions = 112 Number of orfs with sites within 600 bp upstream = 121 Fraction of orfs with sites within 600 bp upstream = 0.0194346 Motif number 3 GCATATCAGACGCCTGGGAAGGCGACACCA 1 179 1 CGCCTGGGAA 0.991063 -32 AGGCATGCTACCACTGCGAATTTAACCACT 2 40 1 CCACTGCGAA 0.980165 -172 TCGCACATTGCTTCTGGAAAGTGATTTGAG 2 90 1 CTTCTGGAAA 0.978054 -122 CGAATTCAAGCCAATGGAAATAACAAATAG 2 127 1 CCAATGGAAA 0.959207 -85 AAATTCTCCTGTAAAAAACGGAATA 2 197 0 CTCCTGTAAA 0.968596 -15 ********** Masking position 5 Map Score: 1.82876 Number of sites scoring better than the average of aligned sites = 402 Number in coding regions = 374 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 30 Fraction of orfs with sites within 600 bp upstream = 0.0048185 Motif number 4 AACATACTACACTATCTTTATGGTTAAAGC 1 35 0 ACTATCTTTA 0.947301 -176 AACAGACTTTACTATCAGTGAGTCAGATGT 1 123 1 ACTATCAGTG 0.94804 -88 GTAAGTTCTGACTCACTGTTGCACAAAAGC 1 151 1 ACTCACTGTT 0.933386 -60 TCATGAGCGAACTATTTGTTATTTCCATTG 2 138 0 ACTATTTGTT 0.978444 -74 TTCGCTCATGACTATTTTTTATCAACCCAA 2 157 1 ACTATTTTTT 0.952725 -55 ********** Masking position 3 Map Score: 0.763767 Number of sites scoring better than the average of aligned sites = 127 Number in coding regions = 109 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 5 ********** No masking Map Score: -7.57849e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -7.57849e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -7.57849e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0