AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i226_Glycyl_TRNA_synthase_ecoli_reg_100.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 glyQ 300 glycine tRNA synthetase, alpha subunit Motif number 1 TTCGTTGAATATGGAAGCGTTATGCAAGGAT 1 24 1 AGGAAGCGTT 0.992007 -277 GAACAGTTCCAGGGAAGCTATGAAATGCGCG 1 109 1 AGGAAGCTAT 0.997406 -192 ACTGCTCTTTACGGAAGGTATAACCGCGCAT 1 133 0 AGGAAGGTAT 0.997417 -168 TACCCGCTGGATGGAAGATATACAGTACGAA 1 234 0 AGGAAGATAT 0.992982 -67 TGTGGATTTAAAGGAAGGGATCAGTATACCC 1 260 0 AGGAAGGGAT 0.997606 -41 * ********* Masking position 6 Map Score: 11.5188 Number of sites scoring better than the average of aligned sites = 48 Number in coding regions = 42 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 2 GCCTGATCCTTGCATAACGCTTCCATATTC 1 30 0 TGCATAACGC 0.984708 -271 AGGATCAGGCGGCAAAACGTTATAACACCG 1 50 1 GGCAAAACGT 0.994225 -251 AACACCGGCGAGCAAAAAATCGACGTCACC 1 73 1 AGCAAAAAAT 0.903031 -228 CATGGAAAGATGCAAAAAATGGCCATCCGC 1 181 0 TGCAAAAAAT 0.942599 -120 GAAAAAGCAGGGCTTAACGCATGGAAAGAT 1 200 0 GGCTTAACGC 0.972164 -101 AGTACGAAACGGGAAAAAGCAGGGCTTAAC 1 212 0 GGGAAAAAGC 0.975291 -89 ********** Masking position 6 Map Score: 4.88962 Number of sites scoring better than the average of aligned sites = 1737 Number in coding regions = 1597 Number in noncoding regions = 140 Number of orfs with sites within 600 bp upstream = 158 Fraction of orfs with sites within 600 bp upstream = 0.0253774 Motif number 3 ATTCAACGAACGCAGAGGATCAA 1 4 0 CGCAGAGGAT 0.980943 -297 TTTCCCGTTTCGTACTGTATATCTTCCATC 1 226 1 CGTACTGTAT 0.982678 -75 GATCAGTATACCCGCTGGATGGAAGATATA 1 243 0 CCCGCTGGAT 0.995054 -58 ATTATTTCGTGCTGGATACGTGTGGAT 1 284 0 CGTGCTGGAT 0.99714 -17 ********** Masking position 9 Map Score: 2.78338 Number of sites scoring better than the average of aligned sites = 777 Number in coding regions = 747 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 30 Fraction of orfs with sites within 600 bp upstream = 0.0048185 Motif number 4 TCCATATTCAACGAACGCAGAGGATCAA 1 7 0 ACAAGCAGAG 0.943725 -294 GGAAGCGTTATGCAAGGATCAGGCGGCAAAAC 1 36 1 TGAAGATCAG 0.966959 -265 CTGGAACTGTTCGAAGGCGGTGACGTCGATTT 1 89 0 TCAAGCGGTG 0.970142 -212 AGGGAAGCTATGAAATGCGCGGTTATACCTTC 1 119 1 TGAAGCGCGG 0.991483 -182 TTATACCTTCCGTAAAGAGCAGTTTGTCTGTT 1 141 1 CGAAGAGCAG 0.97702 -160 GCCATCCGCGTCAAAAGAACAGACAAACTGCT 1 158 0 TCAAGAACAG 0.986657 -143 ACGTGTGGATTTAAAGGAAGGGATCAGTATAC 1 262 0 TTAAGAAGGG 0.921552 -39 ** ** ****** Masking position 5 Map Score: 2.99161 Number of sites scoring better than the average of aligned sites = 597 Number in coding regions = 540 Number in noncoding regions = 57 Number of orfs with sites within 600 bp upstream = 67 Fraction of orfs with sites within 600 bp upstream = 0.0107613 Motif number 5 CAAGGATCAGGCGGCAAAACGTTATAACAC 1 48 1 GCGGCAAAAC 0.992313 -253 TATGAAATGCGCGGTTATACCTTCCGTAAA 1 127 1 GCGGTTATAC 0.996317 -174 CTTCCATCCAGCGGGTATACTGATCCCTTC 1 248 1 GCGGGTATAC 0.997516 -53 ********** Masking position 7 Map Score: 2.6404 Number of sites scoring better than the average of aligned sites = 25 Number in coding regions = 21 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 6 TTCCCTGGAACTGTTCGAAGGCGGTGACGT 1 95 0 CTGTTCGAAG 0.975363 -206 ACAAACTGCTCTTTACGGAAGGTATAACCG 1 138 0 CTTTACGGAA 0.962171 -163 GGAAGATATACAGTACGAAACGGGAAAAAG 1 223 0 CAGTACGAAA 0.994233 -78 CACACGTATCCAGCACGAAATAAT 1 287 1 CAGCACGAAA 0.99019 -14 ********** Masking position 9 Map Score: 2.1866 Number of sites scoring better than the average of aligned sites = 154 Number in coding regions = 144 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0