AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i246_regulatory_cassete1_ecoli_reg_300.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 araC 300 transcriptional regulator for ara operon Motif number 1 GAGTTGCGATAAAAAGCGTCAGGTAGGATCCGCTAAT 1 16 1 AAAAGCGATG 0.99252 -285 CTTATGGATAAAAATGCTATGGCATAGCAAAGTGTGA 1 53 1 AAAAGCTGAG 0.992446 -248 AGCCATGACAAAAACGCGTAACAAAAGTGTCTATAAT 1 127 0 AAAAGCGAAG 0.998151 -174 GCATTCTGTAACAAAGCGGGACCAAAGCCATGACAAA 1 152 0 ACAAGCGAAG 0.994962 -149 GAATGCTTTTAATAAGCGGGGTTACCGGTTGGGTTAG 1 183 1 AATAGCGGAG 0.99525 -118 AAGAGCCAGTAAAAGACGCAGTGACGGCAATGTCTGA 1 224 1 AAAAACGGAG 0.992439 -77 **** *** * * * Masking position 4 Map Score: 7.61527 Number of sites scoring better than the average of aligned sites = 303 Number in coding regions = 270 Number in noncoding regions = 33 Number of orfs with sites within 600 bp upstream = 27 Fraction of orfs with sites within 600 bp upstream = 0.00433665 Motif number 2 AAAATGCTATGGCATAGCAAAGTGTGACGCCGT 1 63 1 GCAGCAAAGT 0.990039 -238 GTCTATAATCACGGCAGAAAAGTCCACATTGAT 1 103 0 AGAGAAAAGT 0.977088 -198 TGACAAAAACGCGTAACAAAAGTGTCTATAATC 1 126 0 GGACAAAAGT 0.993062 -175 CTGTAACAAAGCGGGACCAAAGCCATGACAAAA 1 151 0 GGACCAAAGC 0.988053 -150 AAAAGACGCAGTGACGGCAATGTCTGATGCAAT 1 234 1 GGGGCAATGT 0.979666 -67 TGAATGGTGGGAGTATGAAAAGT 1 288 1 GGTGAAAAGT 0.9882 -13 * * ******** Masking position 9 Map Score: 3.99395 Number of sites scoring better than the average of aligned sites = 298 Number in coding regions = 273 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 35 Fraction of orfs with sites within 600 bp upstream = 0.00562159 Motif number 3 GTAGAGAGTTGCGATAAAAAGCGT 1 5 1 AGAGTTGCGA 0.953438 -296 TTTATCCATAAGATTAGCGGATCCTACCTG 1 35 0 AGATTAGCGG 0.992723 -266 TTAATAAGCGGGGTTACCGGTTGGGTTAGC 1 191 1 GGGTTACCGG 0.99168 -110 GTTACCGGTTGGGTTAGCGAGAAGAGCCAG 1 203 1 GGGTTAGCGA 0.995256 -98 ********** Masking position 5 Map Score: 2.23258 Number of sites scoring better than the average of aligned sites = 240 Number in coding regions = 224 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 4 AAAGTGTGACGCCGTGCAAATAATCAATGT 1 81 1 GCCGTGCAAA 0.985048 -220 GGACTTTTCTGCCGTGATTATAGACACTTT 1 111 1 GCCGTGATTA 0.991175 -190 CGGGACCAAAGCCATGACAAAAACGCGTAA 1 143 0 GCCATGACAA 0.987197 -158 ATCAGACATTGCCGTCACTGCGTCTTTTAC 1 232 0 GCCGTCACTG 0.985302 -69 ********** Masking position 5 Map Score: 1.40132 Number of sites scoring better than the average of aligned sites = 321 Number in coding regions = 302 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 27 Fraction of orfs with sites within 600 bp upstream = 0.00433665 Motif number 5 TGCAAATAATCAATGTGGACTTTTCTGCCG 1 95 1 CAATGTGGAC 0.996957 -206 ATGTCTGATGCAATATGGACAATTGGTTTC 1 253 1 CAATATGGAC 0.995493 -48 ********** Masking position 6 Map Score: 0.50812 Number of sites scoring better than the average of aligned sites = 4 Number in coding regions = 3 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0