AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i257_hsp60_hsp10_ecoli_reg_100.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 mopB 275 GroES, 10 Kd chaperone binds to Hsp60 in pres. Mg-ATP, suppressing its ATPase activity #2 mopA 43 GroEL, chaperone Hsp60, peptide-dependent ATPase, heat shock protein Motif number 1 CCCAAAATTTGGGCGCAATCGGACATCAACCC 1 10 0 GGGGCATCGA 0.972671 -266 CCCAAATTTTGGGCAACTGCGTAGATTTTCGAT 1 30 1 GGGAACGCGA 0.99343 -246 ACAAAATCGGGTGAAAACCCTGATTCACCTCAC 1 115 0 GTGAAACCTA 0.928974 -161 GCCCCTTCAAGGGGGAAAAAGAAAAAAAATTCT 1 155 0 GGGGAAAAGA 0.963485 -121 CCCCTTGAAGGGGCGAAGCCTCATCCCCATTTC 1 174 1 GGGGAACCTA 0.993786 -102 GTCACCAGCCGGGAAACCACGTAAGCTCCGGCG 1 211 1 GGGAACACGA 0.994472 -65 TATCTGTTATGGGTGACGCCGGAGCTTACGTGG 1 227 0 GGGGACCCGA 0.998817 -49 ACTCTCCTTTGAGAAAGTCCGTATCTGTTATGG 1 248 0 GAGAAGCCGA 0.962631 -28 *** *** *** * Masking position 13 Map Score: 10.9093 Number of sites scoring better than the average of aligned sites = 467 Number in coding regions = 423 Number in noncoding regions = 44 Number of orfs with sites within 600 bp upstream = 41 Fraction of orfs with sites within 600 bp upstream = 0.00658529 Motif number 2 GGTTGATGTCCGATTGCGCCCAAATTTTGGG 1 12 1 CGTTGCGCCC 0.995866 -264 CGAAAATCTACGCAGTTGCCCAAAATTTGGG 1 30 0 CGAGTTGCCC 0.987882 -246 GGTGAATCAGGGTTTTCACCCGATTTTGTGC 1 119 1 GGTTTCACCC 0.965434 -157 AATTTTTTTTCTTTTTCCCCCTTGAAGGGGC 1 157 1 CTTTTCCCCC 0.932388 -119 AATGGGGATGAGGCTTCGCCCCTTCAAGGGG 1 174 0 AGCTTCGCCC 0.972692 -102 GTGGTTTCCCGGCTGGTGACCAGAGAAATGG 1 200 0 GGTGGTGACC 0.873787 -76 CCGGAGCTTACGTGGTTTCCCGGCTGGTGAC 1 211 0 CGGGTTTCCC 0.958664 -65 ACGTAAGCTCCGGCGTCACCCATAACAGATA 1 229 1 CGCGTCACCC 0.796668 -47 ** ******** Masking position 10 Map Score: 6.83167 Number of sites scoring better than the average of aligned sites = 1902 Number in coding regions = 1795 Number in noncoding regions = 107 Number of orfs with sites within 600 bp upstream = 106 Fraction of orfs with sites within 600 bp upstream = 0.0170254 Motif number 3 TCCGATTGCGCCCAAATTTTGGGCAACTGC 1 20 1 CCCAAATTTT 0.932414 -256 CACATTTCATCGCAATTTCTTCATCGCCGT 1 88 0 CGCAATTTCT 0.988197 -188 GGGTTTTCACCCGATTTTGTGCTGATCAGA 1 128 1 CCGATTTTGT 0.934548 -148 TTGTGCTGATCAGAATTTTTTTTCTTTTTC 1 144 1 CAGAATTTTT 0.933622 -132 GAAGCCTCATCCCCATTTCTCTGGTCACCA 1 188 1 CCCCATTTCT 0.978753 -88 ATAACAGATACGGACTTTCTCAAAGGAGAG 1 250 1 CGGACTTTCT 0.974963 -26 ********** Masking position 7 Map Score: 3.48061 Number of sites scoring better than the average of aligned sites = 320 Number in coding regions = 282 Number in noncoding regions = 38 Number of orfs with sites within 600 bp upstream = 44 Fraction of orfs with sites within 600 bp upstream = 0.00706714 Motif number 4 GCGCAATCGGACATCAACCC 1 1 0 ACATCAACCC 0.93191 -275 CATCGCAATTTCTTCATCGCCGTCATAAGC 1 81 0 TCTTCATCGC 0.992737 -195 TTCACCTCACATTTCATCGCAATTTCTTCA 1 95 0 ATTTCATCGC 0.936547 -181 GAATTTTTTTTCTTTTTCCCCCTTGAAGGG 1 156 1 TCTTTTTCCC 0.956148 -120 AAGGGGCGAAGCCTCATCCCCATTTCTCTG 1 181 1 GCCTCATCCC 0.985736 -95 TATCTTTATTCCTTAAATTCGT 2 32 0 TCTTTATTCC 0.931842 -12 ********** Masking position 4 Map Score: 3.25999 Number of sites scoring better than the average of aligned sites = 1132 Number in coding regions = 1026 Number in noncoding regions = 106 Number of orfs with sites within 600 bp upstream = 125 Fraction of orfs with sites within 600 bp upstream = 0.0200771 Motif number 5 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0