AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i257_hsp60_hsp10_ecoli_reg_300.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 mopB 275 GroES, 10 Kd chaperone binds to Hsp60 in pres. Mg-ATP, suppressing its ATPase activity #2 mopA 43 GroEL, chaperone Hsp60, peptide-dependent ATPase, heat shock protein Motif number 1 CCCAAAATTTGGGCGCAATCGGACATCAACCC 1 10 0 GGGGCATCGA 0.975568 -266 CCCAAATTTTGGGCAACTGCGTAGATTTTCGAT 1 30 1 GGGAACGCGA 0.99414 -246 ACAAAATCGGGTGAAAACCCTGATTCACCTCAC 1 115 0 GTGAAACCTA 0.936201 -161 GCCCCTTCAAGGGGGAAAAAGAAAAAAAATTCT 1 155 0 GGGGAAAAGA 0.967324 -121 CCCCTTGAAGGGGCGAAGCCTCATCCCCATTTC 1 174 1 GGGGAACCTA 0.994458 -102 GTCACCAGCCGGGAAACCACGTAAGCTCCGGCG 1 211 1 GGGAACACGA 0.99507 -65 TATCTGTTATGGGTGACGCCGGAGCTTACGTGG 1 227 0 GGGGACCCGA 0.998945 -49 ACTCTCCTTTGAGAAAGTCCGTATCTGTTATGG 1 248 0 GAGAAGCCGA 0.966557 -28 *** *** *** * Masking position 13 Map Score: 10.9093 Number of sites scoring better than the average of aligned sites = 467 Number in coding regions = 423 Number in noncoding regions = 44 Number of orfs with sites within 600 bp upstream = 41 Fraction of orfs with sites within 600 bp upstream = 0.00658529 Motif number 2 CCCAAAATTTGGGCGCAATCGGACATCAACC 1 12 0 GGGCGCAACG 0.995236 -264 CCCAAATTTTGGGCAACTGCGTAGATTTTCG 1 30 1 GGGCAACTCG 0.985995 -246 GCACAAAATCGGGTGAAAACCCTGATTCACC 1 119 0 GGGTGAAACC 0.965476 -157 GCCCCTTCAAGGGGGAAAAAGAAAAAAAATT 1 157 0 GGGGGAAAAG 0.922447 -119 CCCCTTGAAGGGGCGAAGCCTCATCCCCATT 1 174 1 GGGCGAAGCT 0.971275 -102 CCATTTCTCTGGTCACCAGCCGGGAAACCAC 1 200 1 GGTCACCACC 0.85767 -76 GTCACCAGCCGGGAAACCACGTAAGCTCCGG 1 211 1 GGGAAACCCG 0.952428 -65 TATCTGTTATGGGTGACGCCGGAGCTTACGT 1 229 0 GGGTGACGCG 0.813343 -47 ******** ** Masking position 2 Map Score: 6.83167 Number of sites scoring better than the average of aligned sites = 1902 Number in coding regions = 1795 Number in noncoding regions = 107 Number of orfs with sites within 600 bp upstream = 106 Fraction of orfs with sites within 600 bp upstream = 0.0170254 Motif number 3 GCAGTTGCCCAAAATTTGGGCGCAATCGGA 1 20 0 AAAATTTGGG 0.940759 -256 ACGGCGATGAAGAAATTGCGATGAAATGTG 1 88 1 AGAAATTGCG 0.989625 -188 TCTGATCAGCACAAAATCGGGTGAAAACCC 1 128 0 ACAAAATCGG 0.942636 -148 GAAAAAGAAAAAAAATTCTGATCAGCACAA 1 144 0 AAAAATTCTG 0.941815 -132 TGGTGACCAGAGAAATGGGGATGAGGCTTC 1 188 0 AGAAATGGGG 0.98149 -88 CTCTCCTTTGAGAAAGTCCGTATCTGTTAT 1 250 0 AGAAAGTCCG 0.978173 -26 ********** Masking position 4 Map Score: 3.48061 Number of sites scoring better than the average of aligned sites = 320 Number in coding regions = 282 Number in noncoding regions = 38 Number of orfs with sites within 600 bp upstream = 44 Fraction of orfs with sites within 600 bp upstream = 0.00706714 Motif number 4 GCGCAATCGGACATCAACCC 1 1 0 ACATCAACCC 0.932336 -275 CATCGCAATTTCTTCATCGCCGTCATAAGC 1 81 0 TCTTCATCGC 0.992785 -195 TTCACCTCACATTTCATCGCAATTTCTTCA 1 95 0 ATTTCATCGC 0.936946 -181 GAATTTTTTTTCTTTTTCCCCCTTGAAGGG 1 156 1 TCTTTTTCCC 0.956429 -120 AAGGGGCGAAGCCTCATCCCCATTTCTCTG 1 181 1 GCCTCATCCC 0.98583 -95 TATCTTTATTCCTTAAATTCGT 2 32 0 TCTTTATTCC 0.932269 -12 ********** Masking position 4 Map Score: 3.25999 Number of sites scoring better than the average of aligned sites = 1132 Number in coding regions = 1026 Number in noncoding regions = 106 Number of orfs with sites within 600 bp upstream = 125 Fraction of orfs with sites within 600 bp upstream = 0.0200771 Motif number 5 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0