AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i273_hypothetical18_ecoli_reg_100.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 yjgP 266 orf, hypothetical protein Motif number 1 CCGCCGTTGTCTTTAAGATTCAGGAGCGTA 1 15 0 CTTTAAGATT 0.990263 -252 GCCGTAATAACGTTAAGATTAACACGAAGT 1 97 0 CGTTAAGATT 0.993684 -170 ACGGATTCACCTCTCAGATTTTGTTCTGAC 1 135 0 CTCTCAGATT 0.98928 -132 TCGAAATCGTCGCTAAGATAATTATACTCA 1 165 0 CGCTAAGATA 0.989723 -102 ********** Masking position 6 Map Score: 5.54356 Number of sites scoring better than the average of aligned sites = 35 Number in coding regions = 29 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 2 TTAAAGACAACGGCGGTGGCTACAGATAGA 1 29 1 CGGCGGTGGC 0.998536 -238 TAACTCATGTCCGCTGTTGCGATGACTTCG 1 73 1 CCGCTGTTGC 0.994915 -194 AACGTTATTACGGCATTGGCACGTCAGAAC 1 113 1 CGGCATTGGC 0.996649 -154 CGTAAAAACTCGTCTTTTGCAGGATTTTAG 1 235 0 CGTCTTTTGC 0.988419 -32 ********** Masking position 7 Map Score: 5.39094 Number of sites scoring better than the average of aligned sites = 467 Number in coding regions = 449 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 3 AAAGACAACGGCGGTGGCTACAGATAGAATT 1 31 1 GCGGTGGTAC 0.967912 -236 CGCAACAGCGGACATGAGTTACGAAAGCTTG 1 63 0 GACATGATTA 0.937552 -204 GTCCGCTGTTGCGATGACTTCGTGTTAATCT 1 81 1 GCGATGATTC 0.995508 -186 CAAAATCTGAGAGGTGAATCCGTTGAGTATA 1 142 1 GAGGTGATCC 0.986963 -125 AATTATCTTAGCGACGATTTCGACGACTCAA 1 172 1 GCGACGATTC 0.989015 -95 TGACGTTTAAGCCATGAAACAAGCTAAAATC 1 212 1 GCCATGAACA 0.922092 -55 ******* *** Masking position 6 Map Score: 3.08791 Number of sites scoring better than the average of aligned sites = 1252 Number in coding regions = 1191 Number in noncoding regions = 61 Number of orfs with sites within 600 bp upstream = 66 Fraction of orfs with sites within 600 bp upstream = 0.0106007 Motif number 4 TAATCTTAACGTTATTACGGCATTGGCACG 1 106 1 GTTATTACGG 0.99459 -161 CTCAGATTTTGTTCTGACGTGCCAATGCCG 1 123 0 GTTCTGACGT 0.98823 -144 CAAAAGACGAGTTTTTACGGGCGTATTTAA 1 246 1 GTTTTTACGG 0.99459 -21 ********** Masking position 7 Map Score: 1.75909 Number of sites scoring better than the average of aligned sites = 80 Number in coding regions = 68 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 5 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0