AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i289_moxr_protein_ecoli_reg_100.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 yieN 198 putative 2-component regulator Motif number 1 GGGCCAAGGGACTAAGCACACATTTCATATTT 1 28 0 ACAAGCCACA 0.997074 -171 GTGCTTAGTCCCTTGGCCCACAAAAAAGCGCA 1 41 1 CCTGGCCACA 0.995839 -158 TTGGCCCACAAAAAAGCGCACAGTATGCACGA 1 53 1 AAAAGCCACA 0.993437 -146 GGCCACATTAACCTGGCTCAAAGAAAAATACC 1 113 1 ACTGGCCAAA 0.995815 -86 TGGTGGCTAAAATAGTCTCAAAGGGGGGGTAT 1 140 0 AAAGTCCAAA 0.966673 -59 ** **** **** Masking position 10 Map Score: 5.29367 Number of sites scoring better than the average of aligned sites = 184 Number in coding regions = 156 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 32 Fraction of orfs with sites within 600 bp upstream = 0.00513974 Motif number 2 AGACTAGTCTTTCGTTGAAA 1 1 1 AGACTAGTCT 0.49917 -198 TGCATACTGTGCGCTTTTTTGTGGGCCAAG 1 52 0 GCGCTTTTTT 0.939061 -147 GCATTTAGGAGTACGATTTTGCCGTTAATC 1 83 0 GTACGATTTT 0.950967 -116 TCTCAAAGGGGGGGTATTTTTCTTTGAGCC 1 127 0 GGGGTATTTT 0.958684 -72 CCCCCCTTTGAGACTATTTTAGCCACCAGC 1 144 1 AGACTATTTT 0.951518 -55 TTGCGAGTATAGACGTTTCTTGCTGGTGGC 1 165 0 AGACGTTTCT 0.961955 -34 ********** Masking position 8 Map Score: 2.14542 Number of sites scoring better than the average of aligned sites = 1089 Number in coding regions = 860 Number in noncoding regions = 229 Number of orfs with sites within 600 bp upstream = 240 Fraction of orfs with sites within 600 bp upstream = 0.038548 Motif number 3 TGCCGTTAATCGTGCATACTGTGCGCTTTT 1 64 0 CGTGCATACT 0.989853 -135 CTCCTAAATGCGGCCACATTAACCTGGCTC 1 102 1 CGGCCACATT 0.987842 -97 CAGCAAGAAACGTCTATACTCGCAATTTAC 1 170 1 CGTCTATACT 0.984087 -29 ********** Masking position 6 Map Score: 0.0993902 Number of sites scoring better than the average of aligned sites = 77 Number in coding regions = 68 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 4 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0