AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i290_oxidoreductase_ecoli_reg_300.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 b1970 84 orf, hypothetical protein #2 b1971 108 putative reductase Motif number 1 ATCCTTGTCATGTGAATGAGTTTTGAGGAT 1 59 0 TGTGAATGAG 0.982019 -26 CTCATTCACATGACAAGGATATAAAC 1 69 1 TGACAAGGAT 0.974648 -16 TCTCTGCTACTGTTAGGGAGGACACTCCCT 2 33 1 TGTTAGGGAG 0.993851 -76 ACTGTTAATCTGTCAGGGAGTGTCCTCCCT 2 47 0 TGTCAGGGAG 0.997735 -62 GACAAAAAAGTGTGATGGCTT 2 98 1 TGTGATGGCT 0.969954 -11 ********** Masking position 5 Map Score: 5.90977 Number of sites scoring better than the average of aligned sites = 158 Number in coding regions = 125 Number in noncoding regions = 33 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 2 GTAATGCTGCTGTAAGGTTACCCTGGACGCTTTT 1 20 1 TGTGTTACCT 0.996507 -65 CCCTGGACGCTTTTTCGCTATCCTCAAAACTCAT 1 40 1 TTTGCTACCT 0.996445 -45 GCAAGAGCCGTTTACTGTTAATCTGTCAGGGAGT 2 56 0 TTTGTTATCT 0.991907 -53 ATCACACTTTTTTGTCGTTAGCCAGCAAGAGCCG 2 80 0 TTTGTTACCA 0.994797 -29 *** **** *** Masking position 9 Map Score: 2.34024 Number of sites scoring better than the average of aligned sites = 58 Number in coding regions = 44 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 3 CAAAATTGTAATGCTGCTGTAAGGTTACCC 1 13 1 ATGCTGCTGT 0.988172 -72 AAGCAGATCTCTGCTACTGTTAGGGAGGAC 2 26 1 CTGCTACTGT 0.995359 -83 CAGCAAGAGCCGTTTACTGTTAATCTGTCA 2 62 0 CGTTTACTGT 0.967567 -47 CAGTAAACGGCTCTTGCTGGCTAACGACAA 2 73 1 CTCTTGCTGG 0.98559 -36 ********** Masking position 5 Map Score: 1.6479 Number of sites scoring better than the average of aligned sites = 820 Number in coding regions = 790 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 35 Fraction of orfs with sites within 600 bp upstream = 0.00562159 Motif number 4 TACAAAATTGTAATGCTGCTG 1 1 1 TAAAAATTGT 0.956208 -84 TTGAGGATAGCGAAAAAGCGTCCAGGGTAAC 1 36 0 CGAAAAGCGT 0.987867 -49 TGCATAAATATGTAAAAGCAGAT 2 3 1 CAAAATATGT 0.971699 -106 TGGCTAACGACAAAAAAGTGTGATGGCTT 2 90 1 CAAAAAGTGT 0.995792 -19 ** ******** Masking position 6 Map Score: 0.932639 Number of sites scoring better than the average of aligned sites = 174 Number in coding regions = 135 Number in noncoding regions = 39 Number of orfs with sites within 600 bp upstream = 57 Fraction of orfs with sites within 600 bp upstream = 0.00915516 Motif number 5 ********** No masking Map Score: 4.00336e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 4.00336e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 4.00336e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0