AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i292_3_ecoli_reg_300.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 ybgI 270 orf, hypothetical protein #2 ybgJ 22 putative carboxylase Motif number 1 ATATTGCATAAATAATCAGATCTGTATCAA 1 84 0 AATAATCAGA 0.989551 -187 TGTATATTTATGCAATCAGACAGCATATTG 1 108 0 TGCAATCAGA 0.988976 -163 TTAACGGTGTAGCTATCAGAATACGGAAGG 1 244 1 AGCTATCAGA 0.98904 -27 CGAATAATCAGAGGGATCGAAA 2 3 1 AATAATCAGA 0.989551 -20 ********** Masking position 5 Map Score: 5.27887 Number of sites scoring better than the average of aligned sites = 44 Number in coding regions = 31 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 2 CGCGCAACTATTACGTGACGTTGCCGTCAA 1 24 0 TTACGTGACG 0.977852 -247 CACGTAATAGTTGCGCGGCGTGCTTGTGTT 1 37 1 TTGCGCGGCG 0.986444 -234 ACATTAGCTGAAGCGTGATGATATAAACAA 1 135 1 AAGCGTGATG 0.977821 -136 ATTAAGAAACAAACCCGACGCCAAAAGACG 1 169 0 AAACCCGACG 0.977218 -102 ACTGGCGAGGTAACGCTATGTTAACGGTGT 1 224 1 TAACGCTATG 0.927837 -47 AGAATACGGAAGGCGCGAAG 1 261 1 AGGCGCGAAG 0.975526 -10 ********** Masking position 4 Map Score: 3.1776 Number of sites scoring better than the average of aligned sites = 2736 Number in coding regions = 2620 Number in noncoding regions = 116 Number of orfs with sites within 600 bp upstream = 127 Fraction of orfs with sites within 600 bp upstream = 0.0203983 Motif number 3 CGTGACGTTGCCGTCAATTGTGGAATTATT 1 11 0 CCGTCAATTG 0.900088 -260 CTGATTATTTATGCAATATGCTGTCTGATT 1 95 1 ATGCAATATG 0.957714 -176 ATGTATATTTATGCAATCAGACAGCATATT 1 109 0 ATGCAATCAG 0.929994 -162 ACGCCAAAAGACGCAAATTGTTTATATCAT 1 152 0 ACGCAAATTG 0.978891 -119 AACAAACCCGACGCCAAAAGACGCAAATTG 1 162 0 ACGCCAAAAG 0.99052 -109 GTTTCTTAATATGTCAAAAGATTGGCTATC 1 189 1 ATGTCAAAAG 0.957348 -82 ********** Masking position 6 Map Score: 3.34867 Number of sites scoring better than the average of aligned sites = 1269 Number in coding regions = 1172 Number in noncoding regions = 97 Number of orfs with sites within 600 bp upstream = 113 Fraction of orfs with sites within 600 bp upstream = 0.0181497 Motif number 4 CAGATCTGATTATTTATGCAATATGCTGTC 1 90 1 TATTTATGCA 0.993582 -181 AGCTAATGTATATTTATGCAATCAGACAGC 1 114 0 TATTTATGCA 0.993582 -157 ********** Masking position 5 Map Score: 1.28642 Number of sites scoring better than the average of aligned sites = 12 Number in coding regions = 6 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 5 ********** No masking Map Score: -7.8627e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -7.8627e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -7.8627e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0