AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i303_mixed18_ecoli_reg_300.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 msrA 205 peptide methionine sulfoxide reductase Motif number 1 TGGATTTTTGTTAAGCCGTTTAACGGCGTTCCAGGG 1 40 0 TTAACCTACG 0.999327 -166 AGTCTGCTTTTTAATCCATATTACTGGATTTTTGTT 1 64 0 TTAACCTACG 0.999327 -142 ATGTTTTACTTTAGACCTATTCACGGTGGTTATTGT 1 118 1 TTAGCCTACG 0.998854 -88 TGTTACAACCTTAACCCCAATGACCGATTTTCGGGA 1 170 1 TTAACCTACG 0.999327 -36 **** ** * ** * Masking position 11 Map Score: 8.80942 Number of sites scoring better than the average of aligned sites = 16 Number in coding regions = 11 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 2 TATTACTGGATTTTTGTTAAGCCGTTTAACG 1 51 0 TTTTGTTAAG 0.989691 -155 TAAGAAATATTTGGGGTTTAGTCTGCTTTTT 1 88 0 TTGGGTTTAG 0.995698 -118 ATTTCTTATGTTTTACTTTAGACCTATTCAC 1 111 1 TTTTCTTTAG 0.972647 -95 AAATCGGTCATTGGGGTTAAGGTTGTAACAA 1 169 0 TTGGGTTAAG 0.995689 -37 **** ****** Masking position 7 Map Score: 3.47454 Number of sites scoring better than the average of aligned sites = 57 Number in coding regions = 45 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 3 GGCAGGAAAAAAGGATATTCAGGAGAAAAT 1 6 0 AAGGTTCGGG 0.997977 -200 AAGCCGTTTAACGGCGTTCCAGGGGCAGGAAAAAA 1 29 0 ACGGTCCGGG 0.999129 -177 AGACCTATTCACGGTGGTTATTGTGTGCAAATACG 1 130 1 ACGGTTATGG 0.99201 -76 AACCCCAATGACCGATTTTCGGGAGAGCGACACC 1 182 1 ACCGTTCGGG 0.998634 -24 **** *** ** * Masking position 8 Map Score: 2.19863 Number of sites scoring better than the average of aligned sites = 219 Number in coding regions = 209 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 4 ATTTTCTCCTGAATATCCTTT 1 2 1 TTTTCTCCTG 0.994086 -204 CTGAATATCCTTTTTTCCTGCCCCTGGAAC 1 19 1 TTTTTTCCTG 0.984032 -187 ATTACTGGATTTTTGTTAAGCCGTTTAACG 1 51 0 TTTTGTTAAG 0.937913 -155 AACCCCAAATATTTCTTATGTTTTACTTTA 1 101 1 ATTTCTTATG 0.965282 -105 ********** Masking position 6 Map Score: 1.40483 Number of sites scoring better than the average of aligned sites = 337 Number in coding regions = 279 Number in noncoding regions = 58 Number of orfs with sites within 600 bp upstream = 67 Fraction of orfs with sites within 600 bp upstream = 0.0107613 Motif number 5 ********** No masking Map Score: -2.46258e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.46258e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -2.46258e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0