AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i324_mixed9_ecoli_reg_300.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 pspA 151 phage shock protein, inner membrane protein #2 pspB 53 phage shock protein #3 pspE 74 phage shock protein #4 ycjM 185 putative polysaccharide hydrolase #5 ycjQ 30 putative oxidoreductase Motif number 1 CAATCCTGAACGCAGAAATCAAGAGGACAA 1 128 1 CGCAGAAATC 0.952618 -24 CCGAACGCGCCGCCGCTCATCGTCTAAGGA 2 28 1 CGCCGCTCAT 0.977427 -26 GGGGAGTTTCGCAAAAATTGTTAAATCTC 3 10 1 CGCAAAAATT 0.946877 -65 GGCGCATAAGCGCCGCTCATGGTGAATTCT 4 12 0 CGCCGCTCAT 0.977427 -174 TGTGAGCTGACGCAAATAATCTATGGGGAT 4 70 0 CGCAAATAAT 0.969199 -116 GTTTTAGTCACGCAGGAAATCATTTTTTAC 4 117 0 CGCAGGAAAT 0.985436 -69 GAGACTACTCCGCAGAAAATAAACTGTCAA 4 159 0 CGCAGAAAAT 0.993386 -27 ********** Masking position 3 Map Score: 8.46786 Number of sites scoring better than the average of aligned sites = 1000 Number in coding regions = 942 Number in noncoding regions = 58 Number of orfs with sites within 600 bp upstream = 63 Fraction of orfs with sites within 600 bp upstream = 0.0101189 Motif number 2 AAATCAAAAAGATAAAAAATTGGCACGCAAATTG 1 75 1 GATAAAAAGC 0.985814 -77 CCTGAACGCAGAAATCAAGAGGACAACATT 1 132 1 GAAATAAGGC 0.98294 -20 AGGTGTGACAGAAAAAAAAACGGCGCATAAGCGC 4 29 0 GAAAAAAAGC 0.996464 -157 CTATGGGGATGTAAATAAGGTGTGACAGAAAAAA 4 46 0 GTAAAAAGGG 0.96634 -140 CTACTCCGCAGAAAATAAACTGTCAATTGAGCAC 4 151 0 GAAAAAAAGC 0.996393 -35 AAAACTCCTTGTAAAGAAACTGGCCGCT 5 5 0 GTAAAAAAGC 0.993422 -26 ***** *** * * Masking position 7 Map Score: 7.48562 Number of sites scoring better than the average of aligned sites = 88 Number in coding regions = 68 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 3 TCAACAGCAACATGCCAGGATGAGTTAGCG 1 25 0 CATGCCAGGA 0.951728 -127 GTATTAACAGTTCAGCAGGACAATCCTGAA 1 108 1 TTCAGCAGGA 0.981011 -44 AATTTTCATCCATAGAAGGACGCTTAC 3 58 1 CATAGAAGGA 0.904972 -17 AAGAATTCACCATGAGCGGCGCTTA 4 6 1 TTCACCATGA 0.939627 -180 GAAATCATTTTTTACCAGGGAAAAAGCGTA 4 102 0 TTTACCAGGG 0.97796 -84 GGCCAGTTTCTTTACAAGGAGTTTTAA 5 14 1 TTTACAAGGA 0.976194 -17 ********** Masking position 7 Map Score: 2.45679 Number of sites scoring better than the average of aligned sites = 667 Number in coding regions = 570 Number in noncoding regions = 97 Number of orfs with sites within 600 bp upstream = 116 Fraction of orfs with sites within 600 bp upstream = 0.0186315 Motif number 4 TAAATCTCAGGCGTATAATGGATGGCAATTT 3 32 1 GCGTAAATGG 0.972484 -43 AAAAAAAACGGCGCATAAGCGCCGCTCATGG 4 20 0 GCGCAAAGCG 0.997396 -166 TTTTTTACCAGGGAAAAAGCGTATTTGTGAG 4 94 0 GGGAAAAGCG 0.987065 -92 ACTGTCAATTGAGCACAAGGGTTTTAGTCAC 4 136 0 GAGCAAAGGG 0.99293 -50 ***** ***** Masking position 5 Map Score: 0.560602 Number of sites scoring better than the average of aligned sites = 109 Number in coding regions = 93 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 5 ********** No masking Map Score: -6.51267e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -6.51267e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -6.51267e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0