AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i334_1_ecoli_reg_100.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 hemA 213 enzyme in alternate path of synthesis of 5-aminolevulinate #2 prfA 41 peptide chain release factor RF-1 #3 yrdD 62 putative DNA topoisomerase #4 smf_2 53 orf, fragment 2 #5 smf_1 129 orf, fragment 1 Motif number 1 TAAAAGAGAGCGCCCCCTTTTGGAGTAATT 1 125 0 CGCCCCCTTT 0.989832 -89 ATTGATCTTACGCATCCTGTATGATGCAAG 1 154 1 CGCATCCTGT 0.995394 -60 AGGCGTAAATGCACCCTGTAAAAAAAGAA 2 23 0 TGCACCCTGT 0.995394 -19 TATTACGCACCGTGAACAGTGCTGA 3 48 0 CGCACCGTGA 0.99224 -15 AAGAATCGCACCTTGTTTTATTAACC 4 38 0 CGCACCTTGT 0.996489 -16 ********** Masking position 8 Map Score: 8.52525 Number of sites scoring better than the average of aligned sites = 160 Number in coding regions = 151 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 2 GCGTTACCGTCCGCTATCGTCTATGTTCAAGT 1 60 1 CGCTACGTCT 0.951313 -154 CGAAAGCCGTTAGATTCTGGCAATTAAGACAA 1 91 0 TGATTTGGCA 0.927415 -123 CAGAATCTAACGGCTTTCGGCAATTACTCCAA 1 104 1 CGCTTCGGCA 0.998578 -110 TAGGGTTAGTCTGCTTGCATCATACAGGATGC 1 165 0 CGCTTCATCA 0.980263 -49 GTGAACAGTGCTGATTTCGCCATAACAACTTA 3 30 0 CGATTCGCCA 0.98915 -33 ATTGCTAAGGCTGCTTATGGCAGGGAGATAAG 5 107 1 CGCTTTGGCA 0.99592 -23 * **** ***** Masking position 5 Map Score: 5.17643 Number of sites scoring better than the average of aligned sites = 1122 Number in coding regions = 912 Number in noncoding regions = 210 Number of orfs with sites within 600 bp upstream = 108 Fraction of orfs with sites within 600 bp upstream = 0.0173466 Motif number 3 TAGCATTAAGGGTTATAACTGCAACGTATCTCAAG 1 25 0 GGTATACAAC 0.995808 -189 GTTAGATTCTGGCAATTAAGACAACTTGAACATAG 1 80 0 GGAATACAAC 0.997073 -134 AACGGCTTTCGGCAATTACTCCAAAAGGGGGCGCT 1 112 1 GGAATACAAA 0.98847 -102 GTCTGCGGGAAATAATACCAACGTTGATAGGG 1 192 0 GGAATACAAC 0.997072 -22 GGGCCTCACTGGTTAATAAAACAAGGTGCGATTCT 4 28 1 GGTAAACAAG 0.964224 -26 ** *** * **** Masking position 8 Map Score: 4.77722 Number of sites scoring better than the average of aligned sites = 35 Number in coding regions = 26 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 4 AAGGGGGCGCTCTCTTTTATTGATCTTACGC 1 136 1 TCTCTTTATT 0.978811 -78 AGTACATCATTTTCTTTTTTTACAGGGTGCA 2 12 1 TTTCTTTTTT 0.968913 -30 TCATTTCTTTAATTCAGCATAAGT 3 4 1 TTTCTTAATT 0.968913 -59 AGAATCGCACCTTGTTTTATTAACCAGTGAG 4 32 0 CTTGTTTATT 0.929177 -22 AGAAAGATTATTTCTTCTATTCTAGACAAAT 5 38 1 TTTCTTTATT 0.990342 -92 ****** **** Masking position 6 Map Score: 2.75975 Number of sites scoring better than the average of aligned sites = 77 Number in coding regions = 49 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 37 Fraction of orfs with sites within 600 bp upstream = 0.00594282 Motif number 5 ATGGCGAAATCAGCACTGTTCACGGTGCGT 3 39 1 CAGCACTGTT 0.962479 -24 AAGCGAAGGGCCTCACTGGTTAATAAAACA 4 21 1 CCTCACTGGT 0.992294 -33 CTCCTGAACACATCTCTGGAGATTT 5 6 0 CATCTCTGGA 0.970541 -124 TAGACAAATCCCCCTCTGATTGACAGCATC 5 60 1 CCCCTCTGAT 0.971491 -70 TGATTGACAGCATCACTGACCAATCGCAAA 5 76 1 CATCACTGAC 0.97837 -54 ********** Masking position 7 Map Score: 1.85403 Number of sites scoring better than the average of aligned sites = 338 Number in coding regions = 312 Number in noncoding regions = 26 Number of orfs with sites within 600 bp upstream = 30 Fraction of orfs with sites within 600 bp upstream = 0.0048185 Motif number 6 ACGTATCTCAAGGACTTGTCATCACT 1 7 0 AGGACTTGTC 0.984753 -207 CAACGTTGATAGGGTTAGTCTGCTTGCATC 1 176 0 AGGGTTAGTC 0.973424 -38 CAATCAGAGGGGGATTTGTCTAGAATAGAA 5 52 0 GGGATTTGTC 0.994153 -78 AGCAATCTTTGCGATTGGTCAGTGATGCTG 5 83 0 GCGATTGGTC 0.981618 -47 ********** Masking position 6 Map Score: 1.12669 Number of sites scoring better than the average of aligned sites = 57 Number in coding regions = 49 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 7 AATAATACCAACGTTGATAGGGTTAGTCTGCT 1 182 0 ACGTTGTAGG 0.993927 -32 AATTCAGCATAAGTTGTTATGGCGAAATCAGC 3 21 1 AAGTTGTAGG 0.991078 -42 CCAATCGCAAAGATTGCTAAGGCTGCTTATGG 5 95 1 AGATTGTAGG 0.987028 -35 TGCTTATGGCAGGGAGATAAGG 5 118 1 AGGGAGTAGG 0.985993 -12 ****** ** ** Masking position 8 Map Score: 0.346392 Number of sites scoring better than the average of aligned sites = 23 Number in coding regions = 18 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 8 ********** No masking Map Score: -8.99385e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -8.99385e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ********** No masking Map Score: -8.99385e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0