AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i334_1_ecoli_reg_300.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 hemA 213 enzyme in alternate path of synthesis of 5-aminolevulinate #2 prfA 41 peptide chain release factor RF-1 #3 yrdD 62 putative DNA topoisomerase #4 smf_2 53 orf, fragment 2 #5 smf_1 129 orf, fragment 1 Motif number 1 TAAAAGAGAGCGCCCCCTTTTGGAGTAATT 1 125 0 CGCCCCCTTT 0.989293 -89 ATTGATCTTACGCATCCTGTATGATGCAAG 1 154 1 CGCATCCTGT 0.995148 -60 AGGCGTAAATGCACCCTGTAAAAAAAGAA 2 23 0 TGCACCCTGT 0.995148 -19 TATTACGCACCGTGAACAGTGCTGA 3 48 0 CGCACCGTGA 0.991827 -15 AAGAATCGCACCTTGTTTTATTAACC 4 38 0 CGCACCTTGT 0.996302 -16 ********** Masking position 8 Map Score: 8.52525 Number of sites scoring better than the average of aligned sites = 160 Number in coding regions = 151 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 2 ACTTGAACATAGACGATAGCGGACGGTAACGC 1 60 0 AGACGTAGCG 0.95162 -154 TTGTCTTAATTGCCAGAATCTAACGGCTTTCG 1 91 1 TGCCAAATCA 0.92786 -123 TTGGAGTAATTGCCGAAAGCCGTTAGATTCTG 1 104 0 TGCCGAAGCG 0.998587 -110 GCATCCTGTATGATGCAAGCAGACTAACCCTA 1 165 1 TGATGAAGCG 0.980391 -49 TAAGTTGTTATGGCGAAATCAGCACTGTTCAC 3 30 1 TGGCGAATCG 0.989221 -33 CTTATCTCCCTGCCATAAGCAGCCTTAGCAAT 5 107 0 TGCCAAAGCG 0.995947 -23 ***** **** * Masking position 8 Map Score: 5.17643 Number of sites scoring better than the average of aligned sites = 1122 Number in coding regions = 912 Number in noncoding regions = 210 Number of orfs with sites within 600 bp upstream = 108 Fraction of orfs with sites within 600 bp upstream = 0.0173466 Motif number 3 CTTGAGATACGTTGCAGTTATAACCCTTAATGCTA 1 25 1 GTTGTATACC 0.996597 -189 CTATGTTCAAGTTGTCTTAATTGCCAGAATCTAAC 1 80 1 GTTGTATTCC 0.997625 -134 AGCGCCCCCTTTTGGAGTAATTGCCGAAAGCCGTT 1 112 0 TTTGTATTCC 0.990629 -102 CCCTATCAACGTTGGTATTATTTCCCGCAGAC 1 192 1 GTTGTATTCC 0.997624 -22 AGAATCGCACCTTGTTTTATTAACCAGTGAGGCCC 4 28 0 CTTGTTTACC 0.970789 -26 **** * *** ** Masking position 8 Map Score: 4.77722 Number of sites scoring better than the average of aligned sites = 35 Number in coding regions = 26 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 4 AAGGGGGCGCTCTCTTTTATTGATCTTACGC 1 136 1 TTCTTTTATT 0.990743 -78 AGTACATCATTTTCTTTTTTTACAGGGTGCA 2 12 1 TTCTTTTTTT 0.970176 -30 TCATTTCTTTAATTCAGCATAAGT 3 4 1 TTCTTTAATT 0.970176 -59 AGAATCGCACCTTGTTTTATTAACCAGTGAG 4 32 0 CTGTTTTATT 0.931941 -22 AGAAAGATTATTTCTTCTATTCTAGACAAAT 5 38 1 TTCTTCTATT 0.979681 -92 * ********* Masking position 6 Map Score: 2.75975 Number of sites scoring better than the average of aligned sites = 102 Number in coding regions = 66 Number in noncoding regions = 36 Number of orfs with sites within 600 bp upstream = 46 Fraction of orfs with sites within 600 bp upstream = 0.00738837 Motif number 5 ACGCACCGTGAACAGTGCTGATTTCGCCAT 3 39 0 AACAGTGCTG 0.962868 -24 TGTTTTATTAACCAGTGAGGCCCTTCGCTT 4 21 0 ACCAGTGAGG 0.992376 -33 AAATCTCCAGAGATGTGTTCAGGAG 5 6 1 TCCAGAGATG 0.970849 -124 GATGCTGTCAATCAGAGGGGGATTTGTCTA 5 60 0 ATCAGAGGGG 0.97179 -70 TTTGCGATTGGTCAGTGATGCTGTCAATCA 5 76 0 GTCAGTGATG 0.978598 -54 ********** Masking position 4 Map Score: 1.85403 Number of sites scoring better than the average of aligned sites = 338 Number in coding regions = 312 Number in noncoding regions = 26 Number of orfs with sites within 600 bp upstream = 30 Fraction of orfs with sites within 600 bp upstream = 0.0048185 Motif number 6 AGTGATGACAAGTCCTTGAGATACGT 1 7 1 GACAAGTCCT 0.985728 -207 GATGCAAGCAGACTAACCCTATCAACGTTG 1 176 1 GACTAACCCT 0.975106 -38 TTCTATTCTAGACAAATCCCCCTCTGATTG 5 52 1 GACAAATCCC 0.994529 -78 CAGCATCACTGACCAATCGCAAAGATTGCT 5 83 1 GACCAATCGC 0.98279 -47 ********** Masking position 5 Map Score: 1.12669 Number of sites scoring better than the average of aligned sites = 57 Number in coding regions = 49 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 7 AGCAGACTAACCCTATCAACGTTGGTATTATT 1 182 1 CCTACAACGT 0.993927 -32 GCTGATTTCGCCATAACAACTTATGCTGAATT 3 21 0 CCTACAACTT 0.991078 -42 CCATAAGCAGCCTTAGCAATCTTTGCGATTGG 5 95 0 CCTACAATCT 0.987028 -35 CCTTATCTCCCTGCCATAAGCA 5 118 0 CCTACTCCCT 0.985993 -12 ** ** ****** Masking position 5 Map Score: 0.346392 Number of sites scoring better than the average of aligned sites = 23 Number in coding regions = 18 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 8 ********** No masking Map Score: -8.99385e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -8.99385e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ********** No masking Map Score: -8.99385e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0