AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i341_weak2_ecoli_reg_300.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 ybiT 218 putative ATP-binding component of a transport system #2 ygiM 241 orf, hypothetical protein #3 cca 63 tRNA nucleotidyl transferase Motif number 1 GATTTTGTGCCTGGCAGGCCATTGGGTTGAGA 1 20 1 CTGGCAGCAT 0.921139 -199 TCACTGTGAGCTGGAATGAACTTATAATGCGC 1 69 0 CTGGAAGACT 0.973709 -150 CCAGCTCACAGTGAAATCAGATGTGTACGAAA 1 87 1 GTGAAACAAT 0.922366 -132 TGCCATAAGTCTGAAAGAAGATCCTGCTCCTC 1 158 0 CTGAAAAAAT 0.916708 -61 AGGCGTATCCTGAAAAGAGATATGACAAACC 1 198 0 CTGAAAGAAT 0.965702 -21 CGTCACTTATGTGACATAACCGATAAGTAAAG 2 14 0 GTGACAAACG 0.94006 -228 ATACTATCTACTGACAAAAAAGATCGCATTAA 2 59 0 CTGACAAAAG 0.950036 -183 GTTTGAAGCAGTGGCAAGACCTGACACAGAGG 2 136 1 GTGGCAGACT 0.98335 -106 AACGATAGTAGTGGCATCAGTGTCGCTACGCA 2 191 0 GTGGCACATG 0.871728 -51 GTCATGGAAAGTGGAACGATAGTAGTGGCATC 2 205 0 GTGGAAGAAG 0.979857 -37 ****** ** ** Masking position 6 Map Score: 9.68964 Number of sites scoring better than the average of aligned sites = 1076 Number in coding regions = 994 Number in noncoding regions = 82 Number of orfs with sites within 600 bp upstream = 96 Fraction of orfs with sites within 600 bp upstream = 0.0154192 Motif number 2 GTTAAGCGAGATTTTGTGCCTGGCAGGCCA 1 11 1 ATTTTGTGCC 0.990872 -208 GAATGAACTTATAATGCGCTTCCAATACTC 1 58 0 ATAATGCGCT 0.835976 -161 ACGAAATCACATTTTTTGCCTTTGGCTTGA 1 113 1 ATTTTTTGCC 0.967335 -106 GACTTATGGCATAATGCGCGGTTTGTCATA 1 179 1 ATAATGCGCG 0.883094 -40 TTCATCGTCACTTATGTGACATAACCGATA 2 21 0 CTTATGTGAC 0.895868 -221 TTAATGCGATCTTTTTTGTCAGTAGATAGT 2 59 1 CTTTTTTGTC 0.790137 -183 AGTAGATAGTATTTTGCGCCAAATTGCCAT 2 79 1 ATTTTGCGCC 0.994226 -163 CTGCTTCAAACTTTTACGCCCGTCAAATTG 2 117 0 CTTTTACGCC 0.963113 -125 ********** Masking position 5 Map Score: 6.2201 Number of sites scoring better than the average of aligned sites = 1784 Number in coding regions = 1613 Number in noncoding regions = 171 Number of orfs with sites within 600 bp upstream = 197 Fraction of orfs with sites within 600 bp upstream = 0.0316415 Motif number 3 TGCCTGGCAGGCCATTGGGTTGAGAATATTAG 1 27 1 GCCATTGTTG 0.991184 -192 CACATTTTTTGCCTTTGGCTTGAGTGTAGACC 1 120 1 GCCTTTGTTG 0.983675 -99 CGCGCATTATGCCATAAGTCTGAAAGAAGATC 1 167 0 GCCATAGCTG 0.989556 -52 AAAAAAGATCGCATTAAGTTCGCCGTTCATCG 2 44 0 GCATTAGTCG 0.923333 -198 CCGTTGCATGGCAATTTGGCGCAAAATACTAT 2 84 0 GCAATTGCGC 0.965217 -158 CATGCAACGGGCAATTTGACGGGCGTAAAAGT 2 106 1 GCAATTGCGG 0.991806 -136 ****** * *** Masking position 5 Map Score: 3.43718 Number of sites scoring better than the average of aligned sites = 491 Number in coding regions = 452 Number in noncoding regions = 39 Number of orfs with sites within 600 bp upstream = 39 Fraction of orfs with sites within 600 bp upstream = 0.00626405 Motif number 4 GGCTTGAGTGTAGACCTTAAGCGAGGAGCAGGA 1 136 1 TAGACTAACG 0.986739 -83 CGCATTAAGTTCGCCGTTCATCGTCACTTATGT 2 34 0 TCGCCTCACG 0.997945 -208 TTGCGCCAAATTGCCATGCAACGGGCAATTTGA 2 92 1 TTGCCTCACG 0.994414 -150 CGCAAAGCATTCGACATCAATCGGAATCCTCTG 2 162 0 TCGACTAACG 0.995097 -80 ***** * ** ** Masking position 7 Map Score: 1.1429 Number of sites scoring better than the average of aligned sites = 138 Number in coding regions = 132 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 5 TGCCTGGCAGGCCATTGGGTTGAGAATATT 1 27 1 GCCATTGGGT 0.98105 -192 CACATTTTTTGCCTTTGGCTTGAGTGTAGA 1 120 1 GCCTTTGGCT 0.973072 -99 GGCCTTTACTTATCGGTTATG 2 2 1 GCCTTTACTT 0.975507 -240 GTCAGGTCTTGCCACTGCTTCAAACTTTTA 2 131 0 GCCACTGCTT 0.992847 -111 CGACACTGATGCCACTACTATCGTTCCACT 2 198 1 GCCACTACTA 0.949303 -44 ********** Masking position 6 Map Score: 2.13576 Number of sites scoring better than the average of aligned sites = 455 Number in coding regions = 422 Number in noncoding regions = 33 Number of orfs with sites within 600 bp upstream = 39 Fraction of orfs with sites within 600 bp upstream = 0.00626405 Motif number 6 ********** No masking Map Score: 1.23167e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 1.23167e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 1.23167e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0