AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i343_weak4_ecoli_reg_100.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 yiaY 189 putative oxidoreductase Motif number 1 ATTTTAAAACTTAATTAATCATTTCC 1 7 0 TTAATTAATC 0.98611 -183 AGTTTTAAAATAAATTAATACAAAATTCTT 1 26 1 TAAATTAATA 0.988455 -164 GTGCTTTTTTTAAATTCATAAGAATTTTGT 1 45 0 TAAATTCATA 0.969049 -145 AGCACATTGTTTAATGAATACAATGTGCTT 1 70 1 TTAATGAATA 0.974732 -120 ATTGATTATCAAAATTAATCTAATAAAAAG 1 97 0 AAAATTAATC 0.974392 -93 ATTAATTTTGATAATCAATAATACTGATCA 1 108 1 ATAATCAATA 0.953865 -82 ********** Masking position 5 Map Score: 8.71427 Number of sites scoring better than the average of aligned sites = 108 Number in coding regions = 56 Number in noncoding regions = 52 Number of orfs with sites within 600 bp upstream = 57 Fraction of orfs with sites within 600 bp upstream = 0.00915516 Motif number 2 TTTGTATTAATTTATTTTAAAACTTAATTA 1 20 0 TTTATTTTAA 0.76106 -170 TTCATAAGAATTTTGTATTAATTTATTTTA 1 31 0 TTTTGTATTA 0.916132 -159 AAACAATGTGCTTTTTTTAAATTCATAAGA 1 52 0 CTTTTTTTAA 0.98253 -138 AAAAAAAGCACATTGTTTAATGAATACAAT 1 64 1 CATTGTTTAA 0.973264 -126 ATAAAAAGCACATTGTATTCATTAAACAAT 1 75 0 CATTGTATTC 0.935265 -115 ATACAATGTGCTTTTTATTAGATTAATTTT 1 87 1 CTTTTTATTA 0.970735 -103 AGCTGCCCGCCCTTTTTTACACTTTCAGGA 1 163 1 CCTTTTTTAC 0.944598 -27 ********** Masking position 6 Map Score: 5.81614 Number of sites scoring better than the average of aligned sites = 771 Number in coding regions = 497 Number in noncoding regions = 274 Number of orfs with sites within 600 bp upstream = 287 Fraction of orfs with sites within 600 bp upstream = 0.046097 Motif number 3 TAAATTAATACAAAATTCTTATGAATTTAA 1 36 1 CAAAATTCTT 0.960555 -154 ATTCATTAAACAATGTGCTTTTTTTAAATT 1 59 0 CAATGTGCTT 0.99175 -131 TTAATGAATACAATGTGCTTTTTATTAGAT 1 80 1 CAATGTGCTT 0.99175 -110 TATTGATTATCAAAATTAATCTAATAAAAA 1 98 0 CAAAATTAAT 0.804902 -92 AAAATATGATCAGTATTATTGATTATCAAA 1 114 0 CAGTATTATT 0.95922 -76 TGAAAATCCTCAGTAAGCTGCCCGCCCTTT 1 148 1 CAGTAAGCTG 0.903626 -42 ********** Masking position 2 Map Score: 5.15799 Number of sites scoring better than the average of aligned sites = 619 Number in coding regions = 543 Number in noncoding regions = 76 Number of orfs with sites within 600 bp upstream = 88 Fraction of orfs with sites within 600 bp upstream = 0.0141343 Motif number 4 TGAATTTAAAAAAAGCACATTGTTTAATGA 1 57 1 AAAAGCACAT 0.995979 -133 TAATCTAATAAAAAGCACATTGTATTCATT 1 82 0 AAAAGCACAT 0.995979 -108 ********** Masking position 4 Map Score: 2.55313 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -3.24418e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -3.24418e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -3.24418e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0