AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i348_weak9_ecoli_reg_100.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 csrA 234 carbon storage regulator; controls glycogen synthesis, gluconeogenesis, cell size and surface properties Motif number 1 AGCGTCAGGCAATGCCGTGGACTCGCTTCA 1 15 1 AATGCCGTGG 0.998784 -220 CGTTAATGCGAATGCCGTGAAGCGAGTCCA 1 32 0 AATGCCGTGA 0.999286 -203 AACAGAATGTAATGCCATGACTGCTTAGAT 1 118 1 AATGCCATGA 0.99717 -117 TATGATGGATAATGCCGGGATACAGAGAGA 1 183 1 AATGCCGGGA 0.998784 -52 ********** Masking position 3 Map Score: 12.2049 Number of sites scoring better than the average of aligned sites = 57 Number in coding regions = 50 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 2 TATCGACAACGATAAAGTCAGGTTGAAGTT 1 63 1 GATAAAGTCA 0.956677 -172 AAGTTTAGCCGATATACACAACTTCAACCT 1 82 0 GATATACACA 0.975386 -153 CTAAACTTAGGTTTAACAGAATGTAATGCC 1 104 1 GTTTAACAGA 0.945175 -131 AGTAAGCAATGACAAACACATTACATCTAA 1 142 0 GACAAACACA 0.979455 -93 ATAATGCCGGGATACAGAGAGACCCGACTC 1 191 1 GATACAGAGA 0.9758 -44 CTCCTTGAAAGATTAAAAGAGTCGGGTCTC 1 209 0 GATTAAAAGA 0.946202 -26 ********** Masking position 6 Map Score: 3.96441 Number of sites scoring better than the average of aligned sites = 381 Number in coding regions = 306 Number in noncoding regions = 75 Number of orfs with sites within 600 bp upstream = 76 Fraction of orfs with sites within 600 bp upstream = 0.0122069 Motif number 3 ATCGTTGTCGATAGCGTTAATGCGAATGCC 1 46 0 ATAGCGTTAA 0.655696 -189 AACGCTATCGACAACGATAAAGTCAGGTTG 1 58 1 ACAACGATAA 0.969702 -177 GCCGATATACACAACTTCAACCTGACTTTA 1 75 0 ACAACTTCAA 0.938196 -160 TTAACAGAATGTAATGCCATGACTGCTTAG 1 116 1 GTAATGCCAT 0.86901 -119 CAAAAAGTAAGCAATGACAAACACATTACA 1 147 0 GCAATGACAA 0.964919 -88 TATCCATCATATAACGCCAAAAAGTAAGCA 1 164 0 ATAACGCCAA 0.983185 -71 ********** Masking position 3 Map Score: 1.63874 Number of sites scoring better than the average of aligned sites = 2921 Number in coding regions = 2712 Number in noncoding regions = 209 Number of orfs with sites within 600 bp upstream = 229 Fraction of orfs with sites within 600 bp upstream = 0.0367812 Motif number 4 ********** No masking Map Score: -2.46258e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.46258e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.46258e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0