AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i009_Nucleotide_Biosynthes_hinf_reg_100.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI0899_HI0900 100 HI0899: dihydrofolate reductase (folA), HI0900: glutamate 5-kinase (gamma-glutamyl kinase) (proB) #2 HI0901 80 conserved hypothetical protein Motif number 1 TAACGTTAATGCCAATTTTAAGAACTTGGA 1 18 0 GCCAATTTTA 0.994585 -83 TATAGTAACGGCAAATTTTAGGGGGATTT 1 82 1 GCAAATTTTA 0.980504 -19 ACAATCTTGAGCTATTTTTATAGGAAAAAT 2 45 1 GCTATTTTTA 0.983864 -36 ATTTTTATAGGAAAAATTTAAGGTAAAACG 2 58 1 GAAAAATTTA 0.891312 -23 ********** Masking position 4 Map Score: 5.35697 Number of sites scoring better than the average of aligned sites = 170 Number in coding regions = 140 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 37 Fraction of orfs with sites within 600 bp upstream = 0.00594282 Motif number 2 CGTTATCACTAAATCAATGAAAAATCACTT 1 43 1 AAATCAATGA 0.992399 -58 AATCAATGAAAAATCACTTAATATCAGGTA 1 54 1 AAATCACTTA 0.990617 -47 TTGGTTGATAAAAGCACTGATTTATGAAAC 2 17 1 AAAGCACTGA 0.996253 -64 ********** Masking position 6 Map Score: 3.3789 Number of sites scoring better than the average of aligned sites = 17 Number in coding regions = 14 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 3 GTTAATGCCAATTTTAAGAACTTGGAAAGG 1 14 0 ATTTTAAGAA 0.955072 -87 AAATCACTTAATATCAGGTATAGTAACGGC 1 64 1 ATATCAGGTA 0.953154 -37 GTAACGGCAAATTTTAGGGGGATTT 1 86 1 ATTTTAGGGG 0.97738 -15 TTGAGCTATTTTTATAGGAAAAATTTAAGG 2 51 1 TTTATAGGAA 0.913096 -30 TATAGGAAAAATTTAAGGTAAAACGATA 2 63 1 ATTTAAGGTA 0.978339 -18 ********** Masking position 6 Map Score: 1.39467 Number of sites scoring better than the average of aligned sites = 396 Number in coding regions = 299 Number in noncoding regions = 97 Number of orfs with sites within 600 bp upstream = 105 Fraction of orfs with sites within 600 bp upstream = 0.0168648 Motif number 4 TTTTCATTGATTTAGTGATAACGTTAATGCC 1 35 0 TTTGTGATAA 0.981966 -66 TGTCCTTTGGTTGATAAAAGCACTGAT 2 7 1 TTGTTGATAA 0.994519 -74 TAGCTCAAGATTGTTTCATAAATCAGTGCTT 2 28 0 TTGTTCATAA 0.980189 -53 *** ******* Masking position 8 Map Score: 0.391317 Number of sites scoring better than the average of aligned sites = 50 Number in coding regions = 43 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 5 ********** No masking Map Score: -3.95472e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -3.95472e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -3.95472e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0