AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i011_CTP_synthase_hinf_reg_100.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI1077 300 CTP synthetase (pyrG) Motif number 1 AATATTTGTCTCAACCAACACATCTCTTGA 1 19 1 TCAACCAACA 0.995863 -282 ACTTAATTTATCATTCAACATTTGTAATGT 1 89 1 TCATTCAACA 0.978784 -212 TAAAAAGGATTAAGCCAAAACTAGCATTGA 1 141 1 TAAGCCAAAA 0.945093 -160 ACAGACAAAATCAACCAAAAGTGCGGTCAA 1 232 0 TCAACCAAAA 0.990729 -69 TTATAGCTAATCATCCTACAGACAAAATCA 1 249 0 TCATCCTACA 0.986517 -52 ********** Masking position 3 Map Score: 7.16071 Number of sites scoring better than the average of aligned sites = 74 Number in coding regions = 67 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 2 ATGCCACTACATACTTATTCAAGCAGTTAA 1 54 0 ATACTTATTC 0.922169 -247 GTGGCATTTAATACTTAATTTATCATTCAA 1 77 1 ATACTTAATT 0.968298 -224 GGATGGTAGTTTACCTGATTTGCGCAATGA 1 173 0 TTACCTGATT 0.90947 -128 CCCGTCTTTGATAGCTAATTATCTTCGATT 1 201 1 ATAGCTAATT 0.979273 -100 ATAAATGATTATAGCTAATCATCCTACAGA 1 257 0 ATAGCTAATC 0.986718 -44 AGGGAACCTAATCTGTATTGGAA 1 288 0 GAACCTAATC 0.940459 -13 ********** Masking position 6 Map Score: 3.42966 Number of sites scoring better than the average of aligned sites = 222 Number in coding regions = 193 Number in noncoding regions = 29 Number of orfs with sites within 600 bp upstream = 24 Fraction of orfs with sites within 600 bp upstream = 0.0038548 Motif number 3 CATATTTTAATATTTGTCTCAACCAACACA 1 11 1 TATTTGTCTC 0.921039 -290 TCTCTTGATGTTTTTAACTGCTTGAATAAG 1 41 1 TTTTTAACTG 0.969564 -260 GGCTTAATCCTTTTTATCCTTGGAAAGGAT 1 127 0 TTTTTATCCT 0.925405 -174 TTATCTTCGATTTTTGACCGCACTTTTGGT 1 219 1 TTTTTGACCG 0.987262 -82 CTTTTGGTTGATTTTGTCTGTAGGATGATT 1 241 1 ATTTTGTCTG 0.96901 -60 ********** Masking position 5 Map Score: 1.90053 Number of sites scoring better than the average of aligned sites = 406 Number in coding regions = 304 Number in noncoding regions = 102 Number of orfs with sites within 600 bp upstream = 87 Fraction of orfs with sites within 600 bp upstream = 0.0139737 Motif number 4 TAAGTATTAAATGCCACTACATACTTATTCAAG 1 61 0 ATCCATACAA 0.995774 -240 AGGATCCACAATCACATTACAAATGTTGAATGA 1 99 0 ATACATACAA 0.993473 -202 ATTATAGCTAATCATCCTACAGACAAAATCAAC 1 247 0 ATATCTACAA 0.957436 -54 AATCATTTATATTCCAATACAGATTAGGTTCCC 1 277 1 ATCCATACAA 0.995769 -24 ** *** **** * Masking position 8 Map Score: 2.05663 Number of sites scoring better than the average of aligned sites = 14 Number in coding regions = 11 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 5 ATTTGTCTCAACCAACACATCTCTTGATGT 1 22 1 ACCAACACAT 0.990365 -279 GAAAGGATCCACAATCACATTACAAATGTT 1 105 0 ACAATCACAT 0.985177 -196 CAGGTAAACTACCATCCCGTCTTTGATAGC 1 186 1 ACCATCCCGT 0.992176 -115 ********** Masking position 4 Map Score: 0.807304 Number of sites scoring better than the average of aligned sites = 22 Number in coding regions = 19 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0