AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i011_CTP_synthase_hinf_reg_300.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI1077 300 CTP synthetase (pyrG) Motif number 1 TCAAGAGATGTGTTGGTTGAGACAAATATT 1 19 0 TGTTGGTTGA 0.996369 -282 ACATTACAAATGTTGAATGATAAATTAAGT 1 89 0 TGTTGAATGA 0.981341 -212 TCAATGCTAGTTTTGGCTTAATCCTTTTTA 1 141 0 TTTTGGCTTA 0.951512 -160 TTGACCGCACTTTTGGTTGATTTTGTCTGT 1 232 1 TTTTGGTTGA 0.991858 -69 TGATTTTGTCTGTAGGATGATTAGCTATAA 1 249 1 TGTAGGATGA 0.988153 -52 ********** Masking position 3 Map Score: 7.16071 Number of sites scoring better than the average of aligned sites = 74 Number in coding regions = 67 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 2 TGCCACTACATACTTATTCAAGCAGTTAAA 1 53 0 TACTTATTCA 0.907333 -248 TGGCATTTAATACTTAATTTATCATTCAAC 1 78 1 TACTTAATTT 0.949009 -223 GATGGTAGTTTACCTGATTTGCGCAATGAA 1 172 0 TACCTGATTT 0.964779 -129 CCGTCTTTGATAGCTAATTATCTTCGATTT 1 202 1 TAGCTAATTA 0.971932 -99 TAAATGATTATAGCTAATCATCCTACAGAC 1 256 0 TAGCTAATCA 0.983876 -45 AGGGAACCTAATCTGTATTGGAAT 1 287 0 AACCTAATCT 0.966732 -14 ********** Masking position 5 Map Score: 4.51117 Number of sites scoring better than the average of aligned sites = 179 Number in coding regions = 142 Number in noncoding regions = 37 Number of orfs with sites within 600 bp upstream = 28 Fraction of orfs with sites within 600 bp upstream = 0.00449727 Motif number 3 CATATTTTAATATTTGTCTCAACCAACACA 1 11 1 TATTTGTCTC 0.924381 -290 TCTCTTGATGTTTTTAACTGCTTGAATAAG 1 41 1 TTTTTAACTG 0.970917 -260 GGCTTAATCCTTTTTATCCTTGGAAAGGAT 1 127 0 TTTTTATCCT 0.928576 -174 TTATCTTCGATTTTTGACCGCACTTTTGGT 1 219 1 TTTTTGACCG 0.987838 -82 CTTTTGGTTGATTTTGTCTGTAGGATGATT 1 241 1 ATTTTGTCTG 0.970387 -60 ********** Masking position 5 Map Score: 1.90053 Number of sites scoring better than the average of aligned sites = 406 Number in coding regions = 304 Number in noncoding regions = 102 Number of orfs with sites within 600 bp upstream = 87 Fraction of orfs with sites within 600 bp upstream = 0.0139737 Motif number 4 CTTGAATAAGTATGTAGTGGCATTTAATACTTA 1 61 1 TTGTATGGAT 0.99573 -240 TCATTCAACATTTGTAATGTGATTGTGGATCCT 1 99 1 TTGTATGTAT 0.993405 -202 GTTGATTTTGTCTGTAGGATGATTAGCTATAAT 1 247 1 TTGTAGATAT 0.957009 -54 GGGAACCTAATCTGTATTGGAATATAAATGATT 1 277 0 TTGTATGGAT 0.995724 -24 * **** *** ** Masking position 6 Map Score: 2.05663 Number of sites scoring better than the average of aligned sites = 14 Number in coding regions = 11 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 5 CAAGCAGTTAAAAACATCAAGAGATGTGTT 1 35 0 AAAACATCAA 0.936666 -266 TTATCCTTGGAAAGGATCCACAATCACATT 1 114 0 AAAGGATCCA 0.984479 -187 CCAAGGATAAAAAGGATTAAGCCAAAACTA 1 134 1 AAAGGATTAA 0.93165 -167 CCTACAGACAAAATCAACCAAAAGTGCGGT 1 235 0 AAATCAACCA 0.935468 -66 TGATTATAGCTAATCATCCTACAGACAAAA 1 252 0 TAATCATCCT 0.885966 -49 ATTGGAATATAAATGATTATAGCTAATCAT 1 265 0 AAATGATTAT 0.871251 -36 ********** Masking position 6 Map Score: 1.32918 Number of sites scoring better than the average of aligned sites = 513 Number in coding regions = 447 Number in noncoding regions = 66 Number of orfs with sites within 600 bp upstream = 50 Fraction of orfs with sites within 600 bp upstream = 0.00803084 Motif number 6 TACAAATGTTGAATGATAAATTAAGTATTAA 1 84 0 GAATGTAAAT 0.960405 -217 GCAATGAACTCAATGCTAGTTTTGGCTTAAT 1 149 0 CAATGTAGTT 0.962627 -152 ATCAAAGACGGGATGGTAGTTTACCTGATTT 1 182 0 GGATGTAGTT 0.988309 -119 GGTCAAAAATCGAAGATAATTAGCTATCAAA 1 207 0 CGAAGTAATT 0.974039 -94 AATCTGTATTGGAATATAAATGATTATAGCT 1 271 0 GGAATTAAAT 0.879644 -30 ***** ***** Masking position 7 Map Score: 0.167492 Number of sites scoring better than the average of aligned sites = 100 Number in coding regions = 89 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0