AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i021_Succinyl-CoA_Synthetase_hinf_reg_100.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI1194 300 glycine cleavage system transcriptional activator (gcvA) #2 HI1196 35 succinyl-CoA synthetase, beta subunit (sucC) Motif number 1 AAAAAACGCCACTCAATGAGAGCAGCGTTT 1 25 1 ACTCAATGAG 0.993777 -276 ATATACAGGAAGTAAATGAGTAACAAATTG 1 73 1 AGTAAATGAG 0.990805 -228 ATTCCTTACTAGTTAATGAGTTTCAGACTT 1 152 0 AGTTAATGAG 0.994765 -149 ATACAACCATACTTAATGATTGGTAATTCC 1 177 0 ACTTAATGAT 0.979518 -124 ********** Masking position 5 Map Score: 5.15274 Number of sites scoring better than the average of aligned sites = 18 Number in coding regions = 14 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 2 GCTCTCATTGAGTGGCGTTTTTTTCATCCCG 1 17 0 AGTGCGTTTT 0.990416 -284 ACCGAACTTGAGTAACAATTTGTTACTCATT 1 87 0 AGTACAATTT 0.936686 -214 TTGTTACTCAAGTTCGGTTTCCCGAACTATA 1 100 1 AGTTGGTTTC 0.938695 -201 TTCAGACTTAAGTATGATGTTGTGTTTGCAT 1 130 0 AGTAGATGTT 0.941892 -171 CTCATTAACTAGTAAGGAATTACCAATCATT 1 162 1 AGTAGGAATT 0.945759 -139 CCAATCATTAAGTATGGTTGTATTGTAAGGA 1 184 1 AGTAGGTTGT 0.980093 -117 GGAAAGGACAAGTGACGTTTTTTTATTTGAG 1 223 1 AGTGCGTTTT 0.990416 -78 **** ****** Masking position 1 Map Score: 4.71774 Number of sites scoring better than the average of aligned sites = 223 Number in coding regions = 170 Number in noncoding regions = 53 Number of orfs with sites within 600 bp upstream = 34 Fraction of orfs with sites within 600 bp upstream = 0.00546097 Motif number 3 CTCTCATTGAGTGGCGTTTTTTTCATCCCGATT 1 14 0 GTGGTTTTTT 0.988837 -287 GTATATTATTAAACCGATTTGGTTAAACGCTGC 1 46 0 AAAGATTTGT 0.821948 -255 CCGAACTTGAGTAACAATTTGTTACTCATTTAC 1 84 0 GTAAATTTTT 0.899902 -217 AGACTTAAGTATGATGTTGTGTTTGCATATAGT 1 125 0 ATGGTTGTTT 0.934045 -176 CAATCATTAAGTATGGTTGTATTGTAAGGAAAA 1 185 1 GTAGTTGTTT 0.977876 -116 GAAAGGACAAGTGACGTTTTTTTATTTGAGGTA 1 224 1 GTGGTTTTTT 0.988665 -77 GTCTATAATGGACAAGATTTATTTCAAATTAGT 1 265 0 GACGATTTTT 0.900792 -36 TTATAAAATTTTCGTCTATAATGGA 1 286 0 ATAATTTTGT 0.745741 -15 GTGAACTGTTTTCATAACCAAAAAG 2 3 1 GAAGTTTTAT 0.907809 -33 *** ***** ** Masking position 8 Map Score: 4.14864 Number of sites scoring better than the average of aligned sites = 660 Number in coding regions = 502 Number in noncoding regions = 158 Number of orfs with sites within 600 bp upstream = 127 Fraction of orfs with sites within 600 bp upstream = 0.0203983 Motif number 4 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0