AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i021_Succinyl-CoA_Synthetase_hinf_reg_300.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI1194 300 glycine cleavage system transcriptional activator (gcvA) #2 HI1196 35 succinyl-CoA synthetase, beta subunit (sucC) Motif number 1 AAAAAACGCCACTCAATGAGAGCAGCGTTT 1 25 1 ACTCAATGAG 0.99343 -276 ATATACAGGAAGTAAATGAGTAACAAATTG 1 73 1 AGTAAATGAG 0.990293 -228 ATTCCTTACTAGTTAATGAGTTTCAGACTT 1 152 0 AGTTAATGAG 0.994472 -149 ATACAACCATACTTAATGATTGGTAATTCC 1 177 0 ACTTAATGAT 0.978392 -124 ********** Masking position 5 Map Score: 5.15274 Number of sites scoring better than the average of aligned sites = 18 Number in coding regions = 14 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 2 GGGATGAAAAAAACGCCACTCAATGAGAGCA 1 18 1 AAACGCACTC 0.991402 -283 CGATTTGGTTAAACGCTGCTCTCATTGAGTG 1 34 0 AAACGTGCTC 0.978494 -267 ATGAGTAACAAATTGTTACTCAAGTTCGGTT 1 88 1 AATTGTACTC 0.893658 -213 ATAGTTCGGGAAACCGAACTTGAGTAACAAT 1 99 0 AAACCAACTT 0.966008 -202 TGCAAACACAACATCATACTTAAGTCTGAAA 1 131 1 ACATCTACTT 0.887107 -170 CCTTACAATACAACCATACTTAATGATTGGT 1 183 0 CAACCTACTT 0.966448 -118 TCAAATAAAAAAACGTCACTTGTCCTTTCCT 1 222 0 AAACGCACTT 0.979525 -79 ***** ***** Masking position 10 Map Score: 4.75118 Number of sites scoring better than the average of aligned sites = 191 Number in coding regions = 155 Number in noncoding regions = 36 Number of orfs with sites within 600 bp upstream = 32 Fraction of orfs with sites within 600 bp upstream = 0.00513974 Motif number 3 TAAAATCGGGATGAAAAAAACGCCAC 1 6 1 TGGGATGAAA 0.973201 -295 TGTTTGCATATAGTTCGGGAAACCGAACTTG 1 108 0 TGTTCGGGAA 0.966156 -193 ACATCATACTTAAGTCTGAAACTCATTAACT 1 141 1 TAGTCTGAAA 0.875565 -160 ACTCATTAACTAGTAAGGAATTACCAATCAT 1 161 1 TGTAAGGAAT 0.938805 -140 TATGGTTGTATTGTAAGGAAAAGGGTAGGAA 1 196 1 TGTAAGGAAA 0.986647 -105 TGTAAGGAAAAGGGTAGGAAAGGACAAGTGA 1 207 1 AGGTAGGAAA 0.971883 -94 ACGTCCTTTTTGGTTATGAAAACAGTTCAC 2 10 0 TGTTATGAAA 0.985241 -26 * ********* Masking position 10 Map Score: 4.38819 Number of sites scoring better than the average of aligned sites = 202 Number in coding regions = 166 Number in noncoding regions = 36 Number of orfs with sites within 600 bp upstream = 30 Fraction of orfs with sites within 600 bp upstream = 0.0048185 Motif number 4 CGGGATGAAAAAAACGCCACTCAATGAGAG 1 17 1 AAAACGCCAC 0.994654 -284 CCGATTTGGTTAAACGCTGCTCTCATTGAG 1 36 0 TAAACGCTGC 0.966604 -265 CTCAAATAAAAAAACGTCACTTGTCCTTTC 1 224 0 AAAACGTCAC 0.99091 -77 ATAACCAAAAAGGACGTCGCGA 2 24 1 AGGACGTCGC 0.981087 -12 ********** Masking position 4 Map Score: 2.05415 Number of sites scoring better than the average of aligned sites = 104 Number in coding regions = 92 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 5 TATTATTAAACCGATTTGGTTAAACGCTGCT 1 45 0 CCATTTGGTT 0.989693 -256 CAATTTGTTACTCATTTACTTCCTGTATATT 1 72 0 CTATTTACTT 0.877933 -229 ATTGGTAATTCCTTACTAGTTAATGAGTTTC 1 158 0 CCTACTAGTT 0.945745 -143 TCCTTTCCTACCCTTTTCCTTACAATACAAC 1 200 0 CCTTTTCCTT 0.964628 -101 AAGATTTATTTCAAATTAGTTTTTCTAATAC 1 254 0 TCAATTAGTT 0.880599 -47 TCGCGACGTCCTTTTTGGTTATGAAAACAG 2 16 0 CCTTTTGGTT 0.989693 -20 ** ******** Masking position 7 Map Score: 1.58466 Number of sites scoring better than the average of aligned sites = 274 Number in coding regions = 233 Number in noncoding regions = 41 Number of orfs with sites within 600 bp upstream = 35 Fraction of orfs with sites within 600 bp upstream = 0.00562159 Motif number 6 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0