AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i028_Glyoxylate_Metabolism_hinf_reg_100.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI0050 74 conserved hypothetical transmembrane protein #2 HI0051 38 conserved hypothetical transmembrane protein #3 HI0052 26 conserved hypothetical protein #4 HI0053 109 zinc-type alcohol dehydrogenase Motif number 1 GAGCTTATAATGTTACTATTATTT 1 5 1 TTATAATGTT 0.975043 -70 TATAATGTTACTATTATTTTGTGTAGTTTA 1 16 1 CTATTATTTT 0.940462 -59 TTTATTCTTATTGTTATTTCTTGGTGTACC 1 42 1 TTGTTATTTC 0.966261 -33 TTCTCCTTATTGATTATGTTTT 3 3 0 TGATTATGTT 0.983024 -24 CCAAAAAGAGTTTTTATGTTTCATAATCAT 4 31 1 TTTTTATGTT 0.982817 -79 ATAAAATTACTTGTTATGTTTAACTATGAT 4 61 0 TTGTTATGTT 0.993631 -49 ACAAGTAATTTTATTCTGTCAATGGCATAT 4 77 1 TTATTCTGTC 0.974978 -33 ********** Masking position 4 Map Score: 10.2847 Number of sites scoring better than the average of aligned sites = 160 Number in coding regions = 121 Number in noncoding regions = 39 Number of orfs with sites within 600 bp upstream = 27 Fraction of orfs with sites within 600 bp upstream = 0.00433665 Motif number 2 TAAGATCCCCTATGTTCAATTTTATAAATT 2 15 1 TATGTTCAAT 0.989959 -24 AAAGAGTTTTTATGTTTCATAATCATATCA 4 35 1 TATGTTTCAT 0.989982 -75 AATTACTTGTTATGTTTAACTATGATATGA 4 57 0 TATGTTTAAC 0.974003 -53 TTAGACTCCTTATATGCCATTGACAGAATA 4 88 0 TATATGCCAT 0.957568 -22 ********** Masking position 5 Map Score: 2.25932 Number of sites scoring better than the average of aligned sites = 67 Number in coding regions = 59 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 3 TTATAATGTTACTATTATTTTGTGTAGTTT 1 15 1 ACTATTATTT 0.874202 -60 TGTGTAGTTTATTCTTATTGTTATTTCTTG 1 35 1 ATTCTTATTG 0.986961 -40 AACTTTCTCCTTATTGATTATGTTTT 3 11 0 CTCCTTATTG 0.98879 -16 AAACATAAAAACTCTTTTTGGAATACCAAA 4 22 0 ACTCTTTTTG 0.961293 -88 TTTTAGACTCCTTATATGCCATTGACA 4 93 0 CTCCTTATAT 0.922473 -17 ********** Masking position 5 Map Score: 1.87097 Number of sites scoring better than the average of aligned sites = 285 Number in coding regions = 208 Number in noncoding regions = 77 Number of orfs with sites within 600 bp upstream = 74 Fraction of orfs with sites within 600 bp upstream = 0.0118856 Motif number 4 AGAATAAACTACACAAAATAATAGTAACAT 1 20 0 ACACAAAATA 0.960254 -55 CCAAGAAATAACAATAAGAATAAACTACAC 1 36 0 ACAATAAGAA 0.944011 -39 TGCTACAGGTACACCAAGAAATAACAATAA 1 49 0 ACACCAAGAA 0.993418 -26 TCTTTTTGGAATACCAAATATCTATTTTT 4 10 0 ATACCAAATA 0.977065 -100 ATAGTTAAACATAACAAGTAATTTTATTCT 4 64 1 ATAACAAGTA 0.977065 -46 ********** Masking position 6 Map Score: 4.79339 Number of sites scoring better than the average of aligned sites = 226 Number in coding regions = 209 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 5 ********** No masking Map Score: 2.72438e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.72438e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 2.72438e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0