AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i078_Lipopolysaccharide_Biosynthesis_3_hinf_reg_100.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI0870.1 300 H. influenzae predicted coding region HI0870.1 #2 HI0873 58 DTDP-glucose 4,6-dehydratase (rffG) #3 HI1537 251 lic-1 operon protein (licA) Motif number 1 TATTACTTTCTTTTTTGATTTTAAGATAAGG 1 89 1 TTTTTGATTT 0.980393 -212 AGATAAGGGATATTTTGATTTTATCTCTCTT 1 112 1 TATTTGATTT 0.932884 -189 TATTTTAGTATATTATGATTTTTTCGGGTGG 1 149 1 TATATGATTT 0.794399 -152 TATTTAAATTTTGTTTGATTTTAACACGTTA 3 45 0 TTGTTGATTT 0.994389 -207 GATTGATTGATTGATTGATTGCATAGCATTT 3 91 0 TTGTTGATTG 0.996474 -161 GATTGATTGATTGATTGATTGATTGATTGAT 3 111 0 TTGTTGATTG 0.996474 -141 GATTGATTGATTGATTGATTGATTGATTGAT 3 127 0 TTGTTGATTG 0.996474 -125 GATTGATTGATTGATTGATTGATTGATTGAT 3 139 0 TTGTTGATTG 0.996474 -113 ATCCTACAATTTGATTGATTGATTGATTGAT 3 151 0 TTGTTGATTG 0.996474 -101 ATCAATCAAATTGTAGGATTTGTTAAAACTT 3 163 1 TTGAGGATTT 0.911296 -89 *** ******* Masking position 8 Map Score: 27.6675 Number of sites scoring better than the average of aligned sites = 149 Number in coding regions = 91 Number in noncoding regions = 58 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 2 TATCTTATCTTATCTTATCT 1 1 1 TATCTTATCT 0.992637 -300 TATCTTATCTTATCTTATCTTATCTTATCT 1 11 1 TATCTTATCT 0.992637 -290 TATCTTATCTTATCTTATCTTATCTTATCT 1 21 1 TATCTTATCT 0.992637 -280 TATCTTATCTTATCTTATCTTTTTCATTGT 1 31 1 TATCTTATCT 0.992637 -270 AATCAAAATATCCCTTATCTTAAAATCAAA 1 102 0 TCCCTTATCT 0.986812 -199 TGATTTTATCTCTCTTATCCGCTATTTTAG 1 127 1 TCTCTTATCC 0.97739 -174 GGAAAATTAATACCTTAAACTATATAAAGG 1 264 1 TACCTTAAAC 0.862363 -37 CTATTTGCATTACCTTAAATTTATTAACCC 2 36 1 TACCTTAAAT 0.917112 -23 ********** Masking position 7 Map Score: 17.5706 Number of sites scoring better than the average of aligned sites = 32 Number in coding regions = 17 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 3 TAACGTGTTAAAATCAAACAAAATTTAAAT 3 45 1 AAATCAAACA 0.951832 -207 AAATGCTATGCAATCAATCAATCAATCAAT 3 91 1 CAATCAATCA 0.99807 -161 ATCAATCAATCAATCAATCAATCAATCAAT 3 103 1 CAATCAATCA 0.99807 -149 ATCAATCAATCAATCAATCAATCAATCAAT 3 123 1 CAATCAATCA 0.99807 -129 ATCAATCAATCAATCAATCAATCAATCAAT 3 135 1 CAATCAATCA 0.99807 -117 ATCAATCAATCAATCAATCAAATTGTAGGA 3 151 1 CAATCAATCA 0.99807 -101 ********** Masking position 6 Map Score: 22.3239 Number of sites scoring better than the average of aligned sites = 81 Number in coding regions = 28 Number in noncoding regions = 53 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 4 ATCTTATCTTTTTCATTGTTCTAGTGCTTT 1 42 1 TTTCATTGTT 0.902947 -259 TGCTTATTACTTTCTTTTTTGATTTTAAGA 1 85 1 TTTCTTTTTT 0.87709 -216 CTAACATTAGAGTAATTTTCATACAAATAC 1 187 0 AGTAATTTTC 0.885473 -114 AGTTTAAGGTATTAATTTTCCCTCCAGAAT 1 255 0 ATTAATTTTC 0.940537 -46 AACACGTTAAAGTTATTTTTGTAAGGCTCT 3 24 0 AGTTATTTTT 0.787676 -228 CATTTTTATATTTAAATTTTGTTTGATTTT 3 54 0 TTTAAATTTT 0.710457 -198 GCATTTTTGTATTCATTTTTATATTTAAAT 3 67 0 ATTCATTTTT 0.980022 -185 TGAGGAAGTATTTCATTTTCTTCATCAGCA 3 204 1 TTTCATTTTC 0.970454 -48 TCAGCATTCCATTCCTTTTTCCTCCATTGG 3 228 1 ATTCCTTTTT 0.928726 -24 ********** Masking position 7 Map Score: 5.49242 Number of sites scoring better than the average of aligned sites = 718 Number in coding regions = 584 Number in noncoding regions = 134 Number of orfs with sites within 600 bp upstream = 124 Fraction of orfs with sites within 600 bp upstream = 0.0199165 Motif number 5 AGCAAGGAAGCAGATATAAAGCACTAGAACA 1 58 0 CAGATATAAG 0.986602 -243 TAAACCCTACCAAATATATAGCTAACATTAG 1 207 0 CAAATATAAG 0.980275 -94 ATAGAGAAAACCTTTATATAGTTTAAGGTAT 1 273 0 CCTTTATAAG 0.953111 -28 TACATATATAGAGAAAACCTTTA 1 288 0 CATATATAAG 0.988719 -13 ******** ** Masking position 6 Map Score: 0.729243 Number of sites scoring better than the average of aligned sites = 8 Number in coding regions = 4 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 6 TTATGATTTTTTCGGGTGGGTATAGAGTAT 1 161 1 TTCGGGTGGG 0.98876 -140 TAGCTATATATTTGGTAGGGTTTATTATTA 1 214 1 TTTGGTAGGG 0.98935 -87 TTGTCCAATATTCTGGAGGGAAAATTAATA 1 246 1 TTCTGGAGGG 0.993083 -55 TTAAAGTTATTTTTGTAAGGCTCTGAATCT 3 18 0 TTTTGTAAGG 0.937949 -234 ********** Masking position 2 Map Score: 1.76839 Number of sites scoring better than the average of aligned sites = 46 Number in coding regions = 28 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 7 AGCACTAGAACAATGAAAAAGATAAGATAA 1 40 0 CAATGAAAAA 0.892164 -261 AAGTAATAAGCAAGGAAGCAGATATAAAGC 1 67 0 CAAGGAAGCA 0.852032 -234 CCTTATCTTAAAATCAAAAAAGAAAGTAAT 1 90 0 AAATCAAAAA 0.842485 -211 TAACGTGTTAAAATCAAACAAAATTTAAAT 3 45 1 AAATCAAACA 0.964491 -207 AAATGCTATGCAATCAATCAATCAATCAAT 3 91 1 CAATCAATCA 0.995501 -161 ATCAATCAATCAATCAATCAATCAATCAAT 3 103 1 CAATCAATCA 0.995501 -149 ATCAATCAATCAATCAATCAATCAATCAAT 3 119 1 CAATCAATCA 0.995501 -133 ATCAATCAATCAATCAATCAATCAATCAAT 3 139 1 CAATCAATCA 0.995501 -113 ATCAATCAATCAATCAATCAAATTGTAGGA 3 151 1 CAATCAATCA 0.995501 -101 ********** Masking position 6 Map Score: 23.1812 Number of sites scoring better than the average of aligned sites = 124 Number in coding regions = 67 Number in noncoding regions = 57 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 8 ********** No masking Map Score: 1.30983e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 1.30983e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ********** No masking Map Score: 1.30983e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0