AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i099_Phosphate_Transport_1_hinf_reg_100.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI1382 90 phosphate ABC transporter, permease protein (pstC) #2 HI1383 300 phosphate ABC transporter, periplasmic-binding protein (pstS) Motif number 1 AATCTCTTTATTTTATACCGCACTTTAT 1 9 1 TATTTTATAC 0.965478 -82 TTTTATACCGCACTTTATACAAAACCTAGC 1 21 1 CACTTTATAC 0.992375 -70 AAGATAACCGCACTTTATTAATGTTAAGTG 1 50 0 CACTTTATTA 0.921743 -41 CACAATTATTTTCTACACTTCGCTAC 2 7 1 TATTTTCTAC 0.895893 -294 GATTTTTTTTCATTTTATGCATAAACATAA 2 67 0 CATTTTATGC 0.988932 -234 TTCCCTTATCCAATTTATGCGAAGTGGGCA 2 167 1 CAATTTATGC 0.972496 -134 ATTGATAATTAACTTTATTCCCAGTTTCTT 2 210 0 AACTTTATTC 0.945664 -91 ********** Masking position 2 Map Score: 7.8458 Number of sites scoring better than the average of aligned sites = 233 Number in coding regions = 199 Number in noncoding regions = 34 Number of orfs with sites within 600 bp upstream = 26 Fraction of orfs with sites within 600 bp upstream = 0.00417604 Motif number 2 TTATACCGCACTTTATACAAAACCTAGCACTT 1 23 1 CTTATCAAAA 0.849732 -68 AAGTATTTTCCAAAATTATTTAAG 1 77 0 GTTTTCCAAA 0.986382 -14 AATTTGTTATGTTTATGCATAAAATGAAAAAA 2 61 1 GTTATCATAA 0.961068 -240 ATCTTATTACGTTTTAACCTTAGGTACGTTAC 2 94 1 GTTTACCTTA 0.947012 -207 GTGCTGGAGCGTCTTTCCCTTATCCAATTTAT 2 153 1 GTTTTCCTTA 0.986384 -148 AAAATCAACCGTTTTTGCAATAATTTGCTGTT 2 261 0 GTTTTCAATA 0.978755 -40 ** *** ***** Masking position 4 Map Score: 2.73429 Number of sites scoring better than the average of aligned sites = 175 Number in coding regions = 139 Number in noncoding regions = 36 Number of orfs with sites within 600 bp upstream = 37 Fraction of orfs with sites within 600 bp upstream = 0.00594282 Motif number 3 ATTTAGATTGCGTAGCGAAGTGTAGAAAAT 2 18 0 CGTAGCGAAG 0.940406 -283 CAAAAGGTAACGTACCTAAGGTTAAAACGT 2 102 0 CGTACCTAAG 0.957008 -199 GTCCGCCGCCCGAACCGATGGATTGATAAT 2 231 0 CGAACCGATG 0.992277 -70 ********** Masking position 4 Map Score: 1.27439 Number of sites scoring better than the average of aligned sites = 8 Number in coding regions = 7 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 4 ********** No masking Map Score: -6.86222e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -6.86222e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -6.86222e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0