AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i125_Multidrug_Resistance_Pump_2_hinf_reg_100.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI0898 182 multidrug resistance protein A (emrA) Motif number 1 TTAATGAATATTCTAAAGATATAGTCTCATT 1 19 0 TTCTAAAGTA 0.977588 -164 CATCTCTTTATTTTCTAGATTAATGAATATT 1 38 0 TTTTCTAGTT 0.977589 -145 GAGTTCCCCTTTTTAAAGTTTCATAATGACC 1 81 1 TTTTAAAGTT 0.996871 -102 TTTTTGATAGTTTTAAAGGTTATCTCAAATA 1 123 1 TTTTAAAGTT 0.996871 -60 AATATCTCATTTTTAAACATTATCCCAGCTT 1 150 1 TTTTAAACTT 0.989069 -33 ******** ** Masking position 7 Map Score: 7.7058 Number of sites scoring better than the average of aligned sites = 134 Number in coding regions = 105 Number in noncoding regions = 29 Number of orfs with sites within 600 bp upstream = 28 Fraction of orfs with sites within 600 bp upstream = 0.00449727 Motif number 2 ATCAAATTAATGAGACTATATCTTT 1 6 1 ATTAATGAGA 0.986374 -177 TATTTTCTAGATTAATGAATATTCTAAAGA 1 31 0 ATTAATGAAT 0.872299 -152 TAATCTAGAAAATAAAGAGATGATGATTTC 1 47 1 AATAAAGAGA 0.976345 -136 ATGAAACTTTAAAAAGGGGAACTCAAGGGA 1 75 0 AAAAAGGGGA 0.957208 -108 TATCAAAAATAAAAATGAAGGGTCATTATG 1 102 0 AAAAATGAAG 0.953852 -81 GATAATGTTTAAAAATGAGATATTTGAGAT 1 144 0 AAAAATGAGA 0.992689 -39 ********** Masking position 5 Map Score: 6.59083 Number of sites scoring better than the average of aligned sites = 192 Number in coding regions = 145 Number in noncoding regions = 47 Number of orfs with sites within 600 bp upstream = 50 Fraction of orfs with sites within 600 bp upstream = 0.00803084 Motif number 3 TAAAGAGATGATGATTTCCCTTGAGTTCCC 1 59 1 ATGATTTCCC 0.996296 -124 ATGATTTCCCTTGAGTTCCCCTTTTTAAAG 1 69 1 TTGAGTTCCC 0.99565 -114 AATGCCTTCCCTAAGCTGGGA 1 172 0 ATGCCTTCCC 0.997228 -11 ********** Masking position 6 Map Score: 3.43227 Number of sites scoring better than the average of aligned sites = 12 Number in coding regions = 9 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 ********** No masking Map Score: 2.227e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.227e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.227e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0