AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i136_Transmembrane_Transport_10_hinf_reg_100.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI1051 77 ABC transporter, ATP-binding protein #2 HI1052 111 transcriptional regulator, araC family, putative Motif number 1 ATTGATTTGTTTTTGTGCTATAATA 1 6 1 TTTGTTTTTG 0.923356 -72 CCTTTTAGAAGTGCATATTATTATAGCACA 1 24 0 GTGCATATTA 0.94391 -54 GCAACGCAGGTTGCCTTTTAGAAGTGCATA 1 37 0 TTGCCTTTTA 0.985552 -41 CTGCGTTGCCTTTCTTTTTAAGGAAAAGAT 1 58 1 TTTCTTTTTA 0.98083 -20 GCCACACCAGTTGGTTATTAATTCAATATA 2 25 0 TTGGTTATTA 0.987523 -87 ATTATGATACTTGCTTATTTATCTCAATTT 2 73 1 TTGCTTATTT 0.978734 -39 ********** Masking position 6 Map Score: 6.16687 Number of sites scoring better than the average of aligned sites = 406 Number in coding regions = 329 Number in noncoding regions = 77 Number of orfs with sites within 600 bp upstream = 67 Fraction of orfs with sites within 600 bp upstream = 0.0107613 Motif number 2 TAGCACAAAAACAAATCAAT 1 1 0 ACAAATCAAT 0.972565 -77 CAGTTGGTTATTAATTCAATATATTTAGGA 2 18 0 TTAATTCAAT 0.958285 -94 ACTTGCTTATTTATCTCAATTTTTATCGCT 2 81 1 TTATCTCAAT 0.984289 -31 TTTATCGCTAACATCTCATT 2 102 1 ACATCTCATT 0.974595 -10 ********** Masking position 6 Map Score: 1.04123 Number of sites scoring better than the average of aligned sites = 196 Number in coding regions = 172 Number in noncoding regions = 24 Number of orfs with sites within 600 bp upstream = 25 Fraction of orfs with sites within 600 bp upstream = 0.00401542 Motif number 3 TGCATATTATTATAGCACAAAAACAAATCA 1 13 0 TATAGCACAA 0.964797 -65 GCCTTTCTTTTTAAGGAAAAGAT 1 65 1 TTAAGGAAAA 0.951665 -13 ATTCAATATATTTAGGAGAACATT 2 5 0 TTTAGGAGAA 0.992349 -107 TGTGGCAAATTATAGGCGGATTAGATTATG 2 49 1 TATAGGCGGA 0.979609 -63 ********** Masking position 4 Map Score: 0.243743 Number of sites scoring better than the average of aligned sites = 101 Number in coding regions = 69 Number in noncoding regions = 32 Number of orfs with sites within 600 bp upstream = 37 Fraction of orfs with sites within 600 bp upstream = 0.00594282 Motif number 4 ********** No masking Map Score: 3.64809e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 3.64809e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 3.64809e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0