AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i136_Transmembrane_Transport_10_hinf_reg_300.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI1051 77 ABC transporter, ATP-binding protein #2 HI1052 111 transcriptional regulator, araC family, putative Motif number 1 TATTATAGCACAAAAACAAATCAAT 1 6 0 CAAAAACAAA 0.929711 -72 TGTGCTATAATAATATGCACTTCTAAAAGG 1 24 1 TAATATGCAC 0.948656 -54 TATGCACTTCTAAAAGGCAACCTGCGTTGC 1 37 1 TAAAAGGCAA 0.986823 -41 ATCTTTTCCTTAAAAAGAAAGGCAACGCAG 1 58 0 TAAAAAGAAA 0.98251 -20 TATATTGAATTAATAACCAACTGGTGTGGC 2 25 1 TAATAACCAA 0.988623 -87 AAATTGAGATAAATAAGCAAGTATCATAAT 2 73 0 AAATAAGCAA 0.980594 -39 ********** Masking position 5 Map Score: 6.16687 Number of sites scoring better than the average of aligned sites = 406 Number in coding regions = 329 Number in noncoding regions = 77 Number of orfs with sites within 600 bp upstream = 67 Fraction of orfs with sites within 600 bp upstream = 0.0107613 Motif number 2 ATTGATTTGTTTTTGTGCTA 1 1 1 ATTGATTTGT 0.970884 -77 TCCTAAATATATTGAATTAATAACCAACTG 2 18 1 ATTGAATTAA 0.955758 -94 AGCGATAAAAATTGAGATAAATAAGCAAGT 2 81 0 ATTGAGATAA 0.98331 -31 AATGAGATGTTAGCGATAAA 2 102 0 AATGAGATGT 0.973027 -10 ********** Masking position 5 Map Score: 1.04123 Number of sites scoring better than the average of aligned sites = 93 Number in coding regions = 80 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 3 TGCATATTATTATAGCACAAAAACAAATCA 1 13 0 TATAGCACAA 0.964797 -65 GCCTTTCTTTTTAAGGAAAAGAT 1 65 1 TTAAGGAAAA 0.951665 -13 ATTCAATATATTTAGGAGAACATT 2 5 0 TTTAGGAGAA 0.992349 -107 TGTGGCAAATTATAGGCGGATTAGATTATG 2 49 1 TATAGGCGGA 0.979609 -63 ********** Masking position 4 Map Score: 0.243743 Number of sites scoring better than the average of aligned sites = 101 Number in coding regions = 69 Number in noncoding regions = 32 Number of orfs with sites within 600 bp upstream = 37 Fraction of orfs with sites within 600 bp upstream = 0.00594282 Motif number 4 ********** No masking Map Score: 3.64809e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 3.64809e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 3.64809e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0