AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i143_Cytochrome-ubiquinol_Oxidase__hinf_reg_300.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI1076 300 cytochrome D ubiquinol oxidase, subunit I (cydA) Motif number 1 GTCAATTTGATCTAAGTCAATTAAATA 1 4 1 AATTGCTAAT 0.965016 -297 TTATTTGTTATATTTTATTTAATTGACTTAGATC 1 19 0 TATTTTTAAT 0.729032 -282 AAATATAACAAATAAGCCCTATTTTTGTATTTAT 1 38 1 AATAGCTATT 0.80853 -263 TTATATCAAAAATGTGATCTATATAGCATTTTTT 1 68 1 AATTGCTATT 0.988323 -233 TCTATATAGCATTTTTTACTATTTTTTATCCTTA 1 85 1 ATTTTCTATT 0.890319 -216 AATAGCCGCCAATTTGGATTATCTCTATAATAAC 1 132 1 AATTGTTATT 0.979421 -169 TTTAACCTTTAAAAATAATTATGTAGATAAGTCA 1 175 1 AAAATTTATT 0.850695 -126 AGCTAAGTTTAAATTGACTTATCTACATAATTAT 1 189 0 AAATGTTATT 0.950074 -112 AAGTCAATTTAAACTTAGCTGATTGGAGTTGAGT 1 203 1 AAATTCTGAT 0.747027 -98 CGATGCCTTAAATAATCCCTAATTACTCAACTCC 1 227 0 AATATCTAAT 0.923356 -74 TGTTGGAACTAATGTTGTTTATACAAAGGAGTTG 1 274 1 AATTTTTATC 0.871195 -27 *** ** **** * Masking position 10 Map Score: 10.6845 Number of sites scoring better than the average of aligned sites = 628 Number in coding regions = 482 Number in noncoding regions = 146 Number of orfs with sites within 600 bp upstream = 133 Fraction of orfs with sites within 600 bp upstream = 0.021362 Motif number 2 GTCAATTTGATCTAAGTCAA 1 1 1 GTCAATTTGA 0.979974 -300 TTTGATCTAAGTCAATTAAATAAAATATAA 1 16 1 GTCAATTAAA 0.899097 -285 CAAAAATAGGGCTTATTTGTTATATTTTAT 1 35 0 GCTTATTTGT 0.828202 -266 TAGAATAGCCGCCAATTTGGATTATCTCTA 1 129 1 GCCAATTTGG 0.948035 -172 AATAACTGGTGTTTTTTTAACCTTTAAAAA 1 160 1 GTTTTTTTAA 0.877788 -141 ATGTAGATAAGTCAATTTAAACTTAGCTGA 1 195 1 GTCAATTTAA 0.980379 -106 AGTAATTAGGGATTATTTAAGGCATCGCCT 1 234 1 GATTATTTAA 0.856389 -67 TTAAGGCATCGCCTTGTTAATCATTGTTGG 1 250 1 GCCTTGTTAA 0.854938 -51 ********** Masking position 7 Map Score: 4.92932 Number of sites scoring better than the average of aligned sites = 751 Number in coding regions = 622 Number in noncoding regions = 129 Number of orfs with sites within 600 bp upstream = 84 Fraction of orfs with sites within 600 bp upstream = 0.0134918 Motif number 3 CCTTATGTTTAGTAGTAGAATAGCCGCCAA 1 114 1 AGTAGTAGAA 0.925583 -187 AAAATAATTATGTAGATAAGTCAATTTAAA 1 186 1 TGTAGATAAG 0.92557 -115 CTTAGCTGATTGGAGTTGAGTAATTAGGGA 1 216 1 TGGAGTTGAG 0.994849 -85 GTTTATACAAAGGAGTTGAGA 1 290 1 AGGAGTTGAG 0.994849 -11 ********** Masking position 4 Map Score: 1.56023 Number of sites scoring better than the average of aligned sites = 44 Number in coding regions = 35 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 4 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0