AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i185_4_6_1_10_hinf_reg_100.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI1190 89 6-pyruvoyl tetrahydrobiopterin synthase, putative #2 HI1191 155 conserved hypothetical protein Motif number 1 CGCAGGTTTTTAATTTAGCAAAAAGGTTTA 2 14 0 TAATTTAGCA 0.986005 -142 AAAACCTGCGAATTGTAGCACAACGACTTC 2 34 1 AATTGTAGCA 0.990925 -122 GGGGAAGTTCTATTTTAGCAAGACAAGTGA 2 81 0 TATTTTAGCA 0.994395 -75 CCTAGTTTTTTATTGTAGGAGGTTTGCGAA 2 130 0 TATTGTAGGA 0.990349 -26 ********** Masking position 6 Map Score: 5.79766 Number of sites scoring better than the average of aligned sites = 32 Number in coding regions = 27 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 2 AGAAAATGCCCAAGCTGTATTTTACGCAATAA 1 30 1 CAAGTTATTT 0.986941 -60 ATATTTCTTTAAACCTTTATTGCGTAAAATAC 1 46 0 AAACTTATTG 0.932103 -44 ATAAAGGTTTAAAGAAATATTTGACTCAAAAA 1 58 1 AAAGATATTT 0.799917 -32 AATTTAGCAAAAAGGTTTACTT 2 1 0 AAAGTTACTT 0.983975 -155 CTTCACATCCAACGAAATATTTCACTTGTCTT 2 60 1 AACGATATTT 0.954338 -96 TTCTAGTGGGGAAGTTCTATTTTAGCAAGACA 2 86 0 GAAGTTATTT 0.987274 -70 **** * ***** Masking position 8 Map Score: 4.84278 Number of sites scoring better than the average of aligned sites = 162 Number in coding regions = 130 Number in noncoding regions = 32 Number of orfs with sites within 600 bp upstream = 27 Fraction of orfs with sites within 600 bp upstream = 0.00433665 Motif number 3 AATACAGCTTGGGCATTTTCTGCATCCACC 1 21 0 GGGCATTTTC 0.98873 -69 GTATTCTAGTGGGGAAGTTCTATTTTAGCA 2 91 0 GGGGAAGTTC 0.988344 -65 GCGAACTACGGGGGGTATTCTAGTGGGGAA 2 105 0 GGGGGTATTC 0.995584 -51 TTTTATTGTAGGAGGTTTGCGAACTACGGG 2 123 0 GGAGGTTTGC 0.983099 -33 ********** Masking position 8 Map Score: 2.44724 Number of sites scoring better than the average of aligned sites = 34 Number in coding regions = 22 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 4 CCCAAGCTGTATTTTACGCAATAAAGGTTT 1 38 1 ATTTTACGCA 0.982655 -52 TTAAAGAAATATTTGACTCAAAAAGGTAGA 1 66 1 ATTTGACTCA 0.975332 -24 CCAACGAAATATTTCACTTGTCTTGCTAAA 2 68 1 ATTTCACTTG 0.920096 -88 GGGAAGTTCTATTTTAGCAAGACAAGTGAA 2 80 0 ATTTTAGCAA 0.915656 -76 ATTTTACCTAGTTTTTTATT 2 146 0 ATTTTACCTA 0.985381 -10 ********** Masking position 6 Map Score: 1.02345 Number of sites scoring better than the average of aligned sites = 307 Number in coding regions = 250 Number in noncoding regions = 57 Number of orfs with sites within 600 bp upstream = 58 Fraction of orfs with sites within 600 bp upstream = 0.00931577 Motif number 5 TATTTCTTTAAACCTTTATTGCGTAAAATA 1 47 0 AACCTTTATT 0.970816 -43 TTTTTCTACCTTTTTGAGTCAAATAT 1 74 0 TACCTTTTTG 0.992433 -16 AAGTAAACCTTTTTGCTAAATTAAA 2 6 1 AACCTTTTTG 0.992402 -150 ATTTTACCTAGTTTTTTATTGTAG 2 142 0 TACCTAGTTT 0.941241 -14 ********** Masking position 5 Map Score: 3.31493 Number of sites scoring better than the average of aligned sites = 85 Number in coding regions = 67 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 6 ********** No masking Map Score: 3.64809e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 3.64809e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 3.64809e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0