AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i185_4_6_1_10_hinf_reg_300.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI1190 89 6-pyruvoyl tetrahydrobiopterin synthase, putative #2 HI1191 155 conserved hypothetical protein Motif number 1 CGCAGGTTTTTAATTTAGCAAAAAGGTTTA 2 14 0 TAATTTAGCA 0.987948 -142 AAAACCTGCGAATTGTAGCACAACGACTTC 2 34 1 AATTGTAGCA 0.992196 -122 GGGGAAGTTCTATTTTAGCAAGACAAGTGA 2 81 0 TATTTTAGCA 0.995173 -75 CCTAGTTTTTTATTGTAGGAGGTTTGCGAA 2 130 0 TATTGTAGGA 0.991691 -26 ********** Masking position 6 Map Score: 5.79766 Number of sites scoring better than the average of aligned sites = 32 Number in coding regions = 27 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 2 TTATTGCGTAAAATACAGCTTGGGCATTTTCT 1 30 0 AAATAACTTG 0.986748 -60 GTATTTTACGCAATAAAGGTTTAAAGAAATAT 1 46 1 CAATAAGTTT 0.9312 -44 TTTTTGAGTCAAATATTTCTTTAAACCTTTAT 1 58 0 AAATATCTTT 0.801627 -32 AAGTAAACCTTTTTGCTAAATT 2 1 1 AAGTAACTTT 0.983738 -155 AAGACAAGTGAAATATTTCGTTGGATGTGAAG 2 60 0 AAATATCGTT 0.95416 -96 TGTCTTGCTAAAATAGAACTTCCCCACTAGAA 2 86 1 AAATAACTTC 0.987076 -70 ***** * **** Masking position 5 Map Score: 4.84278 Number of sites scoring better than the average of aligned sites = 162 Number in coding regions = 130 Number in noncoding regions = 32 Number of orfs with sites within 600 bp upstream = 27 Fraction of orfs with sites within 600 bp upstream = 0.00433665 Motif number 3 GGTGGATGCAGAAAATGCCCAAGCTGTATT 1 21 1 GAAAATGCCC 0.988813 -69 TGCTAAAATAGAACTTCCCCACTAGAATAC 2 91 1 GAACTTCCCC 0.988446 -65 TTCCCCACTAGAATACCCCCCGTAGTTCGC 2 105 1 GAATACCCCC 0.995623 -51 CCCGTAGTTCGCAAACCTCCTACAATAAAA 2 123 1 GCAAACCTCC 0.983245 -33 ********** Masking position 3 Map Score: 2.44724 Number of sites scoring better than the average of aligned sites = 34 Number in coding regions = 22 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 4 CCCAAGCTGTATTTTACGCAATAAAGGTTT 1 38 1 ATTTTACGCA 0.983404 -52 TTAAAGAAATATTTGACTCAAAAAGGTAGA 1 66 1 ATTTGACTCA 0.97639 -24 CCAACGAAATATTTCACTTGTCTTGCTAAA 2 68 1 ATTTCACTTG 0.923335 -88 GGGAAGTTCTATTTTAGCAAGACAAGTGAA 2 80 0 ATTTTAGCAA 0.919059 -76 ATTTTACCTAGTTTTTTATT 2 146 0 ATTTTACCTA 0.986014 -10 ********** Masking position 6 Map Score: 1.02345 Number of sites scoring better than the average of aligned sites = 307 Number in coding regions = 250 Number in noncoding regions = 57 Number of orfs with sites within 600 bp upstream = 58 Fraction of orfs with sites within 600 bp upstream = 0.00931577 Motif number 5 GTATTTTACGCAATAAAGGTTTAAAGAAAT 1 46 1 CAATAAAGGT 0.975298 -44 AATATTTGACTCAAAAAGGTAGAAAAA 1 73 1 TCAAAAAGGT 0.99225 -17 TTTTAATTTAGCAAAAAGGTTTACTT 2 7 0 GCAAAAAGGT 0.994755 -149 ********** Masking position 5 Map Score: 1.32897 Number of sites scoring better than the average of aligned sites = 44 Number in coding regions = 38 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 6 ********** No masking Map Score: 3.64809e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 3.64809e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 3.64809e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0