AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i205_dna_mismatch_repair_hinf_reg_300.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI0701 108 conserved hypothetical protein #2 HI0706 23 lipoprotein #3 HI0707 132 DNA mismatch repair protein (mutS) Motif number 1 CAACAAGAACAAAAGTGCGGTTATTTTAGT 1 23 1 AAAAGTGCGG 0.999069 -86 TTTTCGATAAAAAAGAGCCCTTAACT 1 93 1 AAAAGAGCCC 0.993198 -16 TCTTCCTGTAAAAAGTGCGGTAAAAAATCT 3 11 1 AAAAGTGCGG 0.999069 -122 AAAGCCAGATAAAAGTGCGGTAAAAATTTG 3 44 0 AAAAGTGCGG 0.999069 -89 TTCGGCACCTAAAATAGCCGCCACAAAACC 3 81 1 AAAATAGCCG 0.989951 -52 ********** Masking position 4 Map Score: 15.0214 Number of sites scoring better than the average of aligned sites = 731 Number in coding regions = 442 Number in noncoding regions = 289 Number of orfs with sites within 600 bp upstream = 219 Fraction of orfs with sites within 600 bp upstream = 0.0351751 Motif number 2 AGTGCGGTTATTTTAGTGGATAAATCACGA 1 36 1 TTTTAGTGGA 0.957528 -73 AAGGGCTCTTTTTTATCGAAAATAATTGTG 1 85 0 TTTTATCGAA 0.955992 -24 TTACCGCACTTTTTACAGGAAGA 3 4 0 TTTTACAGGA 0.990669 -129 TGTTGAGATTTTTTACCGCACTTTTTACAG 3 16 0 TTTTACCGCA 0.997147 -117 CTCAACAAATTTTTACCGCACTTTTATCTG 3 39 1 TTTTACCGCA 0.997147 -94 CTTTATTCAGTTTCAAAGCAGGTAATTAG 3 114 1 TTTCAAAGCA 0.93458 -19 ********** Masking position 5 Map Score: 9.00346 Number of sites scoring better than the average of aligned sites = 576 Number in coding regions = 381 Number in noncoding regions = 195 Number of orfs with sites within 600 bp upstream = 146 Fraction of orfs with sites within 600 bp upstream = 0.02345 Motif number 3 TATCCACTAAAATAACCGCACTTTTGTTCT 1 28 0 AATAACCGCA 0.98951 -81 ATAAATCACGAAAAGTCGCATAGAATTTCG 1 55 1 AAAAGTCGCA 0.992656 -54 AAGTGCGGTAAAAAATCTCAACAAATTTTT 3 23 1 AAAAATCTCA 0.937887 -110 CGAAAGGGGAAAAAGCCAGATAAAAGTGCG 3 55 0 AAAAGCCAGA 0.956083 -78 CGGCACCTAAAATAGCCGCCACAAAACCTA 3 83 1 AATAGCCGCC 0.989664 -50 ********** Masking position 4 Map Score: 4.7021 Number of sites scoring better than the average of aligned sites = 298 Number in coding regions = 218 Number in noncoding regions = 80 Number of orfs with sites within 600 bp upstream = 57 Fraction of orfs with sites within 600 bp upstream = 0.00915516 Motif number 4 AACCGCACTTTTGTTCTTGTTGAAGGATTT 1 15 0 TTGTTCTTGT 0.950669 -94 TTATTCCTTATTGTTCCGTTA 2 2 0 TTGTTCCGTT 0.992837 -22 AGTTATTCCTTATTGTTCCGTT 2 12 0 TTATTCCTTA 0.958195 -12 AAACCTATCTTTATTCAGTTTCAAAGCAGG 3 106 1 TTATTCAGTT 0.970459 -27 ********** Masking position 5 Map Score: 0.631344 Number of sites scoring better than the average of aligned sites = 97 Number in coding regions = 85 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 5 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0