AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i211_transcription_translation_hinf_reg_300.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI0295 246 transcription termination factor (rho) #2 HI0758 176 ribosomal protein L31 (rpL31) Motif number 1 AATTTCCCTTAAGTGCTTATTGATAACCTTA 1 10 1 TAAGTGCATT 0.845281 -237 TATTCTAATTAAAAATCAAATAAATAACAATC 1 53 1 AAAAATCATA 0.819076 -194 CTAGACGGCTAAACTTCCAAAATAAGTTCTTA 1 84 1 AAACTTCAAA 0.820842 -163 ACTTCCAAAATAAGTTCTTAAAAAAAGTGCGA 1 96 1 TAAGTTCAAA 0.900458 -151 GTTCTTAAAAAAAGTGCGATGATTTTTATATT 1 109 1 AAAGTGCTGA 0.91615 -138 ATTTTTATATTAAATGCTAATAAAAGCTAGAC 1 130 1 TAAATGCATA 0.96876 -117 AAAAAGAAAAGTGCGGTTAAAAATGCTGA 2 8 1 AAAGTGCTTA 0.955335 -169 AGTGCGGTTAAAAATGCTGATGATTTTACACG 2 20 1 AAAATGCATG 0.946044 -157 TTATACTGAAAAAATGCAGATAAACAAGCTCT 2 57 0 AAAATGCATA 0.967694 -120 GTGTGGGGAGAAAGTTCCTATAGCGGCGTGGC 2 136 1 AAAGTTCATA 0.984404 -41 ******* *** Masking position 3 Map Score: 9.82743 Number of sites scoring better than the average of aligned sites = 706 Number in coding regions = 511 Number in noncoding regions = 195 Number of orfs with sites within 600 bp upstream = 144 Fraction of orfs with sites within 600 bp upstream = 0.0231288 Motif number 2 AATTGTCCGTATTCTAATTAAAAATCAAATA 1 44 1 ATTCAATTAA 0.958615 -203 TCTAATTAAAAATCAAATAAATAACAATCTA 1 56 1 AATCAATAAA 0.783906 -191 TTTATATTAAATGCTAATAAAAGCTAGACAG 1 133 1 ATGCAATAAA 0.987204 -114 GGTAATTTACGTGCCATTCAAAGGGTGCAAG 1 178 1 GTGCATTCAA 0.833878 -69 CAAGCCCACCATTCGAATAATCAATTCTTAT 1 205 1 ATTCAATAAT 0.943881 -42 CGAATAATCAATTCTTATTAATTCCAACATT 1 218 1 ATTCTATTAA 0.805852 -29 AAAAAGAAAAGTGCGGTTAAAAATGCTGATG 2 11 1 GTGCGTTAAA 0.907189 -166 GCGGTTAAAAATGCTGATGATTTTACACGAA 2 23 1 ATGCGATGAT 0.922641 -154 TACTGAAAAAATGCAGATAAACAAGCTCTAT 2 55 0 ATGCGATAAA 0.982242 -122 ACCAAATAGGTTGCGAATTATACTGAAAAAA 2 75 0 TTGCAATTAT 0.869527 -102 AACCTATTTGGTGCCAATTATGGCGTATTAT 2 94 1 GTGCAATTAT 0.963608 -83 **** ****** Masking position 10 Map Score: 9.48555 Number of sites scoring better than the average of aligned sites = 711 Number in coding regions = 620 Number in noncoding regions = 91 Number of orfs with sites within 600 bp upstream = 70 Fraction of orfs with sites within 600 bp upstream = 0.0112432 Motif number 3 TTGGAAGTTTAGCCGTCTAGATTGTTATTT 1 74 0 AGCCGTCTAG 0.986889 -173 TAAAACCCTACGCTGTCTAGCTTTTATTAG 1 146 0 CGCTGTCTAG 0.987426 -101 TATTCACTCACGCGGTGTGGGGAGAAAGTT 2 122 1 CGCGGTGTGG 0.996932 -55 AAGTTCCTATAGCGGCGTGGCTTCATTTTG 2 147 1 AGCGGCGTGG 0.992049 -30 ********** Masking position 8 Map Score: 2.48596 Number of sites scoring better than the average of aligned sites = 12 Number in coding regions = 10 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 4 ********** No masking Map Score: 7.76924e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 7.76924e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.76924e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0