AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i228_6_1_1_17_hinf_reg_100.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI0274 300 glutamyl-tRNA synthetase (gltX) Motif number 1 TTGACCAAGCGGGCGATTAGC 1 2 0 GGGCGATTAG 0.996664 -299 GAGAAGTGGTGGGCGATACCGGTCTCGAAC 1 59 1 GGGCGATACC 0.987205 -242 TAGCTCAGTTGGGAGAGCACCTCCCTTACA 1 104 0 GGGAGAGCAC 0.973904 -197 ACAACATTAAGGGCGATTAGCTCAGTTGGG 1 121 0 GGGCGATTAG 0.996664 -180 TGGCATTATAGGGAGAATGCATTTTCAGTC 1 155 1 GGGAGAATGC 0.978184 -146 ********** Masking position 6 Map Score: 5.95413 Number of sites scoring better than the average of aligned sites = 94 Number in coding regions = 71 Number in noncoding regions = 23 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 2 TTGGTCAAACTTAGTAAAATTAAGAAAACT 1 24 1 TTAGTAAAAT 0.957514 -277 TAAACAAAATTTAATAAAAAGGTATTGACT 1 181 0 TTAATAAAAA 0.96341 -120 TTACGACAATTAAACAAAATTTAATAAAAA 1 191 0 TAAACAAAAT 0.969973 -110 GTCGTAAAAATAAGCATAAAATCCGCTTTT 1 214 1 TAAGCATAAA 0.868534 -87 GTTTGACTTCTAAATAAAAAAGCGGATTTT 1 231 0 TAAATAAAAA 0.974922 -70 TAACCTATCTTCAATAAAATATTAGTCGTT 1 276 0 TCAATAAAAT 0.958079 -25 ********** Masking position 6 Map Score: 5.18349 Number of sites scoring better than the average of aligned sites = 553 Number in coding regions = 359 Number in noncoding regions = 194 Number of orfs with sites within 600 bp upstream = 163 Fraction of orfs with sites within 600 bp upstream = 0.0261805 Motif number 3 CTTTTTAGAGAAGTGGTGGGCGATACCGGT 1 52 1 AAGTGGTGGG 0.994829 -249 CCTCCCTTACAAGGAGGGGGTCACTGGTTC 1 85 0 AAGGAGGGGG 0.994205 -216 CCCTCCTTGTAAGGGAGGTGCTCTCCCAAC 1 97 1 AAGGGAGGTG 0.95757 -204 GCGATTAGCTCAGTTGGGAGAGCACCTCCC 1 109 0 CAGTTGGGAG 0.969486 -192 ATCGCCCTTAATGTTGTGGGTTGGCATTAT 1 134 1 ATGTTGTGGG 0.974228 -167 ********** Masking position 3 Map Score: 2.42297 Number of sites scoring better than the average of aligned sites = 77 Number in coding regions = 49 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 4 CCACCACTTCTCTAAAAAGTTTTCTTAATT 1 41 0 TCTAAAAAGT 0.971029 -260 GATACCGGTCTCGAACCAGTGACCCCCTCC 1 73 1 TCGAACCAGT 0.978054 -228 TGTTTAATTGTCGTAAAAATAAGCATAAAA 1 205 1 TCGTAAAAAT 0.925164 -96 TATTTAGAAGTCAAACAAGTCGTAGTAGAA 1 245 1 TCAAACAAGT 0.984605 -56 TAACCTATCTTCAATAAAATATTAGTCGTT 1 276 0 TCAATAAAAT 0.888794 -25 ********** Masking position 8 Map Score: 1.82403 Number of sites scoring better than the average of aligned sites = 121 Number in coding regions = 96 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0