AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i242_hfl_operon_hinf_reg_100.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI0151 109 hflK protein (hflK) Motif number 1 GATTTTATATAAGGATTTTTTTGA 1 5 0 AAGGATTTTT 0.943021 -105 ATATAAAATCAAGGATTTTTTATTGCCTAA 1 25 1 AAGGATTTTT 0.943021 -85 ATGAAAATACAAGGCTTTTTAGGCAATAAA 1 43 0 AAGGCTTTTT 0.993431 -67 CTAAACTCTTAACAATTTTTTGACAA 1 94 1 AACAATTTTT 0.674463 -16 ********** Masking position 6 Map Score: 11.3504 Number of sites scoring better than the average of aligned sites = 76 Number in coding regions = 57 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 2 AAAAAAATCCTTATATAAAATCAAGGATTT 1 13 1 TTATATAAAA 0.78562 -97 GGATTTTTTATTGCCTAAAAAGCCTTGTAT 1 37 1 TTGCCTAAAA 0.991928 -73 CCCCATTTATTTAGCTAAACTCTTAACAAT 1 80 1 TTAGCTAAAC 0.984155 -30 TTGTCAAAAAATTGTTAAGA 1 100 0 TTGTCAAAAA 0.98065 -10 ********** Masking position 7 Map Score: 3.60225 Number of sites scoring better than the average of aligned sites = 257 Number in coding regions = 201 Number in noncoding regions = 56 Number of orfs with sites within 600 bp upstream = 44 Fraction of orfs with sites within 600 bp upstream = 0.00706714 Motif number 3 TCCTTATATAAAATCAAGGATTTTTTATTG 1 20 1 AAATCAAGGA 0.977621 -90 GCTTTTTAGGCAATAAAAAATCCTTGATTT 1 30 0 CAATAAAAAA 0.928973 -80 ACGTCTATGAAAATACAAGGCTTTTTAGGC 1 49 0 AAATACAAGG 0.987705 -61 GAGTTTAGCTAAATAAATGGGGCACGTCTA 1 72 0 AAATAAATGG 0.987152 -38 ********** Masking position 4 Map Score: 1.23412 Number of sites scoring better than the average of aligned sites = 299 Number in coding regions = 241 Number in noncoding regions = 58 Number of orfs with sites within 600 bp upstream = 52 Fraction of orfs with sites within 600 bp upstream = 0.00835207 Motif number 4 ********** No masking Map Score: 1.16119e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.16119e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.16119e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0