AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i264_hypothetical1_hinf_reg_100.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI1150 35 conserved hypothetical protein #2 HI1151 88 conserved hypothetical protein Motif number 1 AAACATTGAAATTTTCATCCGCACTTTG 1 9 1 AAATTTTCAT 0.952091 -27 TATTTTTTCCTATTAAAAATT 2 2 1 ATTTTTTCCT 0.992616 -87 AAATGTTGAAAATTTTTAATAGGAAAAAAT 2 12 0 AATTTTTAAT 0.961579 -77 AATTTTCAACATTTTATCTTATTTTTAAAG 2 28 1 ATTTTATCTT 0.98324 -61 ATTGGCGTGCATTTTACCATAAACTTTAAA 2 51 0 ATTTTACCAT 0.964599 -38 AATGCACGCCAATTTTTATAAAGGATAAAA 2 68 1 AATTTTTATA 0.790778 -21 TTTTTATCCTTTATAAAAAT 2 79 0 TTTTTATCCT 0.955434 -10 ********** Masking position 5 Map Score: 8.5039 Number of sites scoring better than the average of aligned sites = 1307 Number in coding regions = 1007 Number in noncoding regions = 300 Number of orfs with sites within 600 bp upstream = 253 Fraction of orfs with sites within 600 bp upstream = 0.040636 Motif number 2 CGGATGAAAATTTCAATGTTT 1 1 0 TTTCAAGTTT 0.996913 -35 TATTAAAAATTTTCAACATTTTATCTTATTT 2 21 1 TTTCAAATTT 0.991671 -68 TTTATCTTATTTTTAAAGTTTATGGTAAAAT 2 40 1 TTTTAAGTTT 0.99526 -49 TTTTTATCCTTTATAAAAATTG 2 77 0 TTTTATCTTT 0.978335 -12 ****** **** Masking position 5 Map Score: 5.57604 Number of sites scoring better than the average of aligned sites = 124 Number in coding regions = 96 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 28 Fraction of orfs with sites within 600 bp upstream = 0.00449727 Motif number 3 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0