AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i265_hypothetical10_hinf_reg_300.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI0386 300 conserved hypothetical protein Motif number 1 CGCATAGAAACGCTAAATATCAAGAATAAA 1 29 1 CGCTAAATAT 0.953574 -272 TAAATATCAAGAATAAAAATACTGGTGGCT 1 42 1 GAATAAAAAT 0.862404 -259 AAATACTGGTGGCTTAAGATTACATAGAGG 1 58 1 GGCTTAAGAT 0.947462 -243 CATAACCGTTCTTTAAAAATAGCCTCTATG 1 80 0 CTTTAAAAAT 0.944457 -221 CAATGAGAAAGGTTAAAAATGATTTGTCAT 1 128 1 GGTTAAAAAT 0.990304 -173 TTGCTAGTCAGGCTAAAAGTGCGGTAAAAA 1 169 1 GGCTAAAAGT 0.977145 -132 GCTAAAAGTGCGGTAAAAATTTTAGATGTT 1 180 1 CGGTAAAAAT 0.97362 -121 AATTTTAGATGTTTTAAAATGAATAAAATC 1 197 1 GTTTTAAAAT 0.898545 -104 ********** Masking position 6 Map Score: 8.13202 Number of sites scoring better than the average of aligned sites = 687 Number in coding regions = 527 Number in noncoding regions = 160 Number of orfs with sites within 600 bp upstream = 135 Fraction of orfs with sites within 600 bp upstream = 0.0216833 Motif number 2 AATAACCGCAAAGATTGTCGC 1 2 1 ATAACCGCAA 0.898703 -299 ATTGTCGCATAGAAACGCTAAATATCAAGA 1 24 1 AGAAACGCTA 0.984104 -277 TTAAGATTACATAGAGGCTATTTTTAAAGA 1 71 1 ATAGAGGCTA 0.970744 -230 CTATTTTTAAAGAACGGTTATGTTTTGAAT 1 88 1 AGAACGGTTA 0.988473 -213 TTACTCAATGAGAAAGGTTAAAAATGATTT 1 123 1 AGAAAGGTTA 0.986118 -178 ATCTTTTGCTAGTCAGGCTAAAAGTGCGGT 1 164 1 AGTCAGGCTA 0.966389 -137 TCAGGCTAAAAGTGCGGTAAAAATTTTAGA 1 176 1 AGTGCGGTAA 0.930836 -125 ********** Masking position 1 Map Score: 7.64179 Number of sites scoring better than the average of aligned sites = 539 Number in coding regions = 364 Number in noncoding regions = 175 Number of orfs with sites within 600 bp upstream = 134 Fraction of orfs with sites within 600 bp upstream = 0.0215226 Motif number 3 GCGACAATCTTTGCGGTTATT 1 2 0 TTGCGGTTAT 0.962768 -299 TCTTGATATTTAGCGTTTCTATGCGACAAT 1 24 0 TAGCGTTTCT 0.956849 -277 TAAGATTACATAGAGGCTATTTTTAAAGAA 1 72 1 TAGAGGCTAT 0.964515 -229 ATGTTTTGAATAGATTTTACTCAATGAGAA 1 107 1 TAGATTTTAC 0.915952 -194 GTAAAAATTTTAGATGTTTTAAAATGAATA 1 192 1 TAGATGTTTT 0.958198 -109 AAAACTCAATAAGATTTTATTCATTTTAAA 1 209 0 AAGATTTTAT 0.88027 -92 TAAAATCTTATTGAGTTTTTCATAGATAGC 1 220 1 TTGAGTTTTT 0.944613 -81 ********** Masking position 8 Map Score: 3.54691 Number of sites scoring better than the average of aligned sites = 297 Number in coding regions = 235 Number in noncoding regions = 62 Number of orfs with sites within 600 bp upstream = 60 Fraction of orfs with sites within 600 bp upstream = 0.00963701 Motif number 4 ATCTTAAGCCACCAGTATTTTTATTCTTGA 1 48 0 ACCAGTATTT 0.990428 -253 TCAAAACATAACCGTTCTTTAAAAATAGCC 1 86 0 ACCGTTCTTT 0.979254 -215 GTATTCTAGAACCAGTTTTTGGGATAAGCA 1 251 0 ACCAGTTTTT 0.990406 -50 ********** Masking position 1 Map Score: 0.544848 Number of sites scoring better than the average of aligned sites = 24 Number in coding regions = 20 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0