AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i283_hypothetical8_hinf_reg_100.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI1678 300 kpsF protein (kpsF) Motif number 1 GGTAAGAGCGCACCGTGCCGTTGGTAA 1 7 0 CACCGTGCGT 0.963277 -294 CGGCACGGTGCGCTCTTACCGCACCCTTTCA 1 18 1 CGCTCTTCCG 0.974541 -283 CGCACCCTTTCACCCTTACCGTTTACACGGC 1 37 1 CACCCTTCCG 0.981297 -264 CGGCTCACGCCGCCCGGACGTTATCCGGCAC 1 94 1 CGCCCGGCGT 0.995055 -207 CGTTATCCGGCACTCTGCCCTGTGTAGCTCG 1 112 1 CACTCTGCCT 0.993921 -189 TGCCCTGTGTAGCTCGGACTTTCCTCTCGTT 1 127 1 AGCTCGGCTT 0.903722 -174 TTACTTGTCCCACTAGGTCGTATAAATACGG 1 157 1 CACTAGGCGT 0.986725 -144 TTGTCTAACCAACTCGGCGCGTAGTATAGGG 1 212 1 AACTCGGGCG 0.910856 -89 TAGGGGCAATCACTAGTGCGGTCAATAAAAT 1 238 1 CACTAGTCGG 0.969077 -63 ******* *** Masking position 3 Map Score: 10.8163 Number of sites scoring better than the average of aligned sites = 142 Number in coding regions = 124 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 2 TTACCAACGGCACGGTGCGCTCT 1 4 1 CCAACGGCAC 0.973085 -297 ACGGTGCGCTCTTACCGCACCCTTTCACCC 1 22 1 CTTACCGCAC 0.987066 -279 GTTTACACGGCGGTCTGCTCTCTGTTGCAC 1 57 1 CGGTCTGCTC 0.917014 -244 GTTGCACTGGTCGTCGGCTCACGCCGCCCG 1 80 1 TCGTCGGCTC 0.97866 -221 TCGGCTCACGCCGCCCGGACGTTATCCGGC 1 93 1 CCGCCCGGAC 0.977922 -208 GCCCGGACGTTATCCGGCACTCTGCCCTGT 1 105 1 TATCCGGCAC 0.904982 -196 GTAGCTCGGACTTTCCTCTCGTTTACTTGT 1 135 1 CTTTCCTCTC 0.841658 -166 GGGGATTTTATTGACCGCACTAGTGATTGC 1 243 0 TTGACCGCAC 0.983757 -58 ********** Masking position 5 Map Score: 5.25142 Number of sites scoring better than the average of aligned sites = 1051 Number in coding regions = 826 Number in noncoding regions = 225 Number of orfs with sites within 600 bp upstream = 186 Fraction of orfs with sites within 600 bp upstream = 0.0298747 Motif number 3 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0