AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i287_hypothetical_nitrate_reductase_hinf_reg_300.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI0345 300 ferredoxin-type protein (napG) Motif number 1 GCCATGACGTAAACCACGTGCTTGTGCATCT 1 19 0 AAACACGTGC 0.990896 -282 GGTAAATACTAAGCCACGAGGTGGTTTATTA 1 112 0 AAGCACGAGG 0.963344 -189 GACCTGCATCAAAGAAAGTGGTAAATACTAA 1 131 0 AAAAAAGTGG 0.991845 -170 AACCGACTTCAAAAAATGTGCGGTAAAAGTG 1 211 1 AAAAATGTGC 0.979648 -90 TGATGGGAGAAAATAAAGTGCGGTTGATTTT 1 267 0 AAAAAAGTGC 0.991845 -34 TTCTCCCATCAATAAAAGAGGAAG 1 287 1 AATAAAGAGG 0.951954 -14 *** ******* Masking position 6 Map Score: 6.45539 Number of sites scoring better than the average of aligned sites = 221 Number in coding regions = 182 Number in noncoding regions = 39 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 2 TTTACGTCATGGCGATAAAATTAAGATTTC 1 37 1 GGCGATAAAA 0.985758 -264 ATTTCGCCTCGACGAGATGAAATCTTAATT 1 55 0 GACGAGATGA 0.937861 -246 ATCTCGTCGAGGCGAAATGATTTCTTATTT 1 67 1 GGCGAAATGA 0.980862 -234 GATACTCGCGGACGTAATAAACCACCTCGT 1 98 1 GACGTAATAA 0.9176 -203 TCAAAAAATGTGCGGTAAAAGTGGAAAAGG 1 219 1 TGCGGTAAAA 0.937874 -82 TGGAAAAGGCTGCGTAAAAACCATGTAAAA 1 240 1 TGCGTAAAAA 0.962598 -61 CTTTTATTGATGGGAGAAAATAAAGTGCGG 1 275 0 TGGGAGAAAA 0.908804 -26 ********** Masking position 7 Map Score: 5.11933 Number of sites scoring better than the average of aligned sites = 766 Number in coding regions = 693 Number in noncoding regions = 73 Number of orfs with sites within 600 bp upstream = 47 Fraction of orfs with sites within 600 bp upstream = 0.00754899 Motif number 3 CACCCATTAGATGCACAAGCACGTGGT 1 7 1 TTAGATGCCA 0.949417 -294 GATTTCTTATTTAGATACTCGCGGACGTAAT 1 85 1 TTAGATACCG 0.977646 -216 TACCACTTTCTTTGATGCAGGTCAGCTTGCA 1 139 1 TTTGATGCGG 0.995145 -162 GTCGGTTTCTTTTGAAATTGGGTCTGTCGCA 1 187 0 TTTGAAATGG 0.965858 -114 CCGCACATTTTTTGAAGTCGGTTTCTTTTGA 1 203 0 TTTGAAGTGG 0.984554 -98 ******** ** Masking position 5 Map Score: 2.3473 Number of sites scoring better than the average of aligned sites = 104 Number in coding regions = 92 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 4 ACGTGGTTTACGTCATGGCGATAAAATTAA 1 31 1 CGTCATGGCG 0.591718 -270 GATTTCATCTCGTCGAGGCGAAATGATTTC 1 61 1 CGTCGAGGCG 0.937314 -240 TAATAAACCACCTCGTGGCTTAGTATTTAC 1 112 1 CCTCGTGGCT 0.994305 -189 ********** Masking position 3 Map Score: 3.25361 Number of sites scoring better than the average of aligned sites = 12 Number in coding regions = 9 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0