AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i312_mixed26_hinf_reg_100.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI0549 169 dimethyladenosine transferase (ksgA) Motif number 1 TTTAGGCGGAAAAGTTAAGAAAAACGGGCG 1 11 1 AAAGTTAAGA 0.984449 -159 TCTTTCGTAGAAAGCTAAAAACGGCTATAA 1 43 0 AAAGCTAAAA 0.996614 -127 GCTTTCTACGAAAGAAAAAATAATATTGTT 1 58 1 AAAGAAAAAA 0.977123 -112 AATGATTTACAAAGCTAAAACAACCCCTAT 1 118 1 AAAGCTAAAA 0.996614 -52 ********** Masking position 7 Map Score: 7.34136 Number of sites scoring better than the average of aligned sites = 32 Number in coding regions = 23 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 2 CGGGCGGATTATAGCCGTTTTTAGCTTTCTA 1 35 1 ATAGCCGTTT 0.917603 -135 GTTATGCCAAATTGAGTTTTTCATGAACAAT 1 82 0 ATTGAGTTTT 0.962948 -88 TGCGGTTATTATAGGGGTTGTTTTAGCTTTG 1 127 0 ATAGGGGTTT 0.991643 -43 TAATAAGAAAAGTGCGGTTATTATAGGGGTT 1 139 0 AGTGCGGTTT 0.970543 -31 ********* * Masking position 8 Map Score: 1.5265 Number of sites scoring better than the average of aligned sites = 191 Number in coding regions = 127 Number in noncoding regions = 64 Number of orfs with sites within 600 bp upstream = 54 Fraction of orfs with sites within 600 bp upstream = 0.00867331 Motif number 3 CGGCTATAATCCGCCCGTTTTTCTTAACTT 1 22 0 CCGCCCGTTT 0.997916 -148 GGGCGGATTATAGCCGTTTTTAGCTTTCTA 1 36 1 TAGCCGTTTT 0.976673 -134 CCTATAATAACCGCACTTTTCTTATTAAAT 1 143 1 CCGCACTTTT 0.995317 -27 ********** Masking position 8 Map Score: 1.01798 Number of sites scoring better than the average of aligned sites = 728 Number in coding regions = 449 Number in noncoding regions = 279 Number of orfs with sites within 600 bp upstream = 213 Fraction of orfs with sites within 600 bp upstream = 0.0342114 Motif number 4 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0