AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i319_mixed4_hinf_reg_100.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI0299 115 prepilin peptidase dependent protein D Motif number 1 ATCGCAAAAAAAAGGAAAAATGT 1 4 0 AAAGGAAAAA 0.997244 -112 TGCGATCCTGATCGCAAAAAAAAGGAAAAA 1 14 0 ATCGCAAAAA 0.994684 -102 TGCGATCAGGATCGCAGAAAAAGTGCGGTC 1 28 1 ATCGCAGAAA 0.988276 -88 GACATTGTGAAAAGGAAAAATTTGTTTGTA 1 63 0 AAAGGAAAAA 0.997244 -53 AGGCTTAATAAAAGGAAAATGA 1 104 1 AAAGGAAAAT 0.990988 -12 ********** Masking position 6 Map Score: 11.7871 Number of sites scoring better than the average of aligned sites = 182 Number in coding regions = 132 Number in noncoding regions = 50 Number of orfs with sites within 600 bp upstream = 58 Fraction of orfs with sites within 600 bp upstream = 0.00931577 Motif number 2 ACATTTTTCCTTTTTTTTGCGATCAGGAT 1 9 1 CCTTTTTTTG 0.970227 -107 AAAGTGCGGTCAATTTTACAAACAAATTTTT 1 47 1 CAATTTACAA 0.955823 -69 ACAAATTTTTCCTTTTCACAATGTCGTTGCC 1 68 1 CCTTTTACAA 0.99542 -48 TCATTTTCCTTTTATTAAGCCTTTGTTG 1 98 0 CCTTTTTTAA 0.99293 -18 ****** **** Masking position 6 Map Score: 1.54758 Number of sites scoring better than the average of aligned sites = 113 Number in coding regions = 93 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 26 Fraction of orfs with sites within 600 bp upstream = 0.00417604 Motif number 3 CATTTTTCCTTTTTTTTGCGATCAGGATCG 1 12 1 TTTTTTTGCG 0.99661 -104 TTGACCGCACTTTTTCTGCGATCCTGATCG 1 30 0 TTTTTCTGCG 0.994235 -86 AAAGGAAAAATTTGTTTGTAAAATTGACCG 1 53 0 TTTGTTTGTA 0.986666 -63 TTATTAAGCCTTTGTTGGCAACGACATTGT 1 85 0 TTTGTTGGCA 0.994235 -31 ********** Masking position 5 Map Score: 6.46518 Number of sites scoring better than the average of aligned sites = 150 Number in coding regions = 131 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 4 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0