AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i334_1_hinf_reg_100.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI0658 160 ABC transporter, ATP-binding protein #2 HI1560 22 H. influenzae predicted coding region HI1560 #3 HI1561 106 peptide chain release factor 1 (prfA) Motif number 1 AAACTATTTATAATATAACAAGTCAATATA 1 22 0 TAATATAACA 0.653077 -139 AAAAGCCACGTATAATAAGACGCAATAAAA 1 50 0 TATAATAAGA 0.828603 -111 ATTTTCTAGTCAAAAAAGCCACGTATAATA 1 63 0 CAAAAAAGCC 0.877678 -98 AGAAAATCGATAAAATCGGAATAGACTGTT 1 86 1 TAAAATCGGA 0.97949 -75 AAAAATATTGCAAAATAGCCTCAAATTAAG 1 127 1 CAAAATAGCC 0.966575 -34 AAAATAGCCTCAAATTAAGACCTATGTAGA 1 138 1 CAAATTAAGA 0.942598 -23 CTGAAATCAGATGTCCCTATC 2 12 0 TGAAATCAGA 0.870154 -11 GGGTAAATCACAAATAAAGCGTCTGAGATT 3 12 1 CAAATAAAGC 0.845386 -95 CAGCGAAAAGGAAATTAAGAATCTCAGACG 3 31 0 GAAATTAAGA 0.823437 -76 CAATTTTCCCTAAAATCGGCTAGAATACGC 3 62 1 TAAAATCGGC 0.984636 -45 TCACCGAAAATAAAATCGGCGTATTCTAGC 3 80 0 TAAAATCGGC 0.984636 -27 ********** Masking position 4 Map Score: 11.539 Number of sites scoring better than the average of aligned sites = 1521 Number in coding regions = 1254 Number in noncoding regions = 267 Number of orfs with sites within 600 bp upstream = 226 Fraction of orfs with sites within 600 bp upstream = 0.0362994 Motif number 2 TGACTAGAAAATCGATAAAATCGGAATAGA 1 81 1 ATCGATAAAA 0.854484 -80 AATAGACTGTTCCGAGAAAAGAAAAAATAT 1 105 1 TCCGAGAAAA 0.989984 -56 GGGAAAATTGACAGCGAAAAGGAAATTAAG 3 42 0 ACAGCGAAAA 0.989991 -65 CTAGCCGATTTTAGGGAAAATTGACAGCGA 3 55 0 TTAGGGAAAA 0.971543 -52 TTGTAAGTCACCGAAAATAAAATCGGC 3 90 0 TCACCGAAAA 0.975714 -17 ********** Masking position 7 Map Score: 2.27964 Number of sites scoring better than the average of aligned sites = 261 Number in coding regions = 220 Number in noncoding regions = 41 Number of orfs with sites within 600 bp upstream = 32 Fraction of orfs with sites within 600 bp upstream = 0.00513974 Motif number 3 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0