AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i338_weak1_hinf_reg_100.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI1556 59 2-hydroxyacid dehydrogenase #2 HI1560 22 H. influenzae predicted coding region HI1560 #3 HI1561 106 peptide chain release factor 1 (prfA) Motif number 1 ATTTCATCAAAAGTGCGGTTAATTTTG 1 6 1 ATCAAAAGCG 0.994174 -54 CCTTTTTTATATACAAAGTGCGGTCAAAATTA 1 30 0 ATACAAAGCG 0.994786 -30 CACTTTGTATATAAAAAAGGAGCAATTA 1 42 1 ATAAAAAGAG 0.987688 -18 TGGGTAAATCACAAATAAAGCGTCTGAGATTC 3 11 1 ACAAATAGCG 0.979272 -96 TCAATTTTCCCTAAAATCGGCTAGAATACGCC 3 61 1 CTAAAATGCT 0.940274 -46 GTCACCGAAAATAAAATCGGCGTATTCTAGCC 3 79 0 ATAAAATGCG 0.996421 -28 ******* *** Masking position 5 Map Score: 8.05067 Number of sites scoring better than the average of aligned sites = 515 Number in coding regions = 370 Number in noncoding regions = 145 Number of orfs with sites within 600 bp upstream = 115 Fraction of orfs with sites within 600 bp upstream = 0.0184709 Motif number 2 TTCATCAAAAGTGCGGTTAATTTTGACCGC 1 13 1 GTGCGGTTAA 0.996838 -47 TATATACAAAGTGCGGTCAAAATTAACCGC 1 25 0 GTGCGGTCAA 0.997995 -35 AATTTCCTTTTCGCTGTCAATTTTCCCTAA 3 45 1 TCGCTGTCAA 0.98912 -62 ********** Masking position 9 Map Score: 3.46262 Number of sites scoring better than the average of aligned sites = 418 Number in coding regions = 262 Number in noncoding regions = 156 Number of orfs with sites within 600 bp upstream = 127 Fraction of orfs with sites within 600 bp upstream = 0.0203983 Motif number 3 TGATAGGGACATCTGATTTCAG 2 3 1 ATAGGGACAT 0.960049 -20 GGGAAAATTGACAGCGAAAAGGAAATTAAG 3 42 0 ACAGCGAAAA 0.993717 -65 CTAGCCGATTTTAGGGAAAATTGACAGCGA 3 55 0 TTAGGGAAAA 0.99031 -52 TTGTAAGTCACCGAAAATAAAATCGGC 3 90 0 TCACCGAAAA 0.983344 -17 ********** Masking position 7 Map Score: 2.16036 Number of sites scoring better than the average of aligned sites = 160 Number in coding regions = 133 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 24 Fraction of orfs with sites within 600 bp upstream = 0.0038548 Motif number 4 ATTTCATCAAAAGTGCGGTTAATTTTGACC 1 11 1 AAGTGCGGTT 0.947088 -49 TTTATATACAAAGTGCGGTCAAAATTAACC 1 27 0 AAGTGCGGTC 0.991395 -33 ********** Masking position 4 Map Score: 2.14656 Number of sites scoring better than the average of aligned sites = 439 Number in coding regions = 317 Number in noncoding regions = 122 Number of orfs with sites within 600 bp upstream = 111 Fraction of orfs with sites within 600 bp upstream = 0.0178285 Motif number 5 GACGCTTTATTTGTGATTTACCCA 3 3 0 TTGTATTACC 0.996293 -104 GCGTCTGAGATTCTTAATTTCCTTTTCGCTGT 3 30 1 TTCTATTTCC 0.990123 -77 TTCCTTTTCGCTGTCAATTTTCCCTAAAATCG 3 48 1 CTGTATTTTC 0.975415 -59 TTGTAAGTCACCGAAAATAAAA 3 95 0 TTGTATCACC 0.993696 -12 **** * ***** Masking position 6 Map Score: 1.66716 Number of sites scoring better than the average of aligned sites = 43 Number in coding regions = 39 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 6 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0