AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i339_weak10_hinf_reg_100.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI1010 158 3-hydroxyisobutyrate dehydrogenase, putative Motif number 1 TTCAAATCAGATTATGAGCTCATAACGTTT 1 18 1 ATTATGAGCT 0.989497 -141 ATTTTTTATCATTCTGTGATCTAGATCTCA 1 74 1 ATTCTGTGAT 0.988761 -85 CAATAAATTAAATCTGAGATCTAGATCACA 1 88 0 AATCTGAGAT 0.985641 -71 TTATCTGTATATTAGCCGATACAATAAATT 1 109 0 ATTAGCCGAT 0.969212 -50 GTTAAGATCTATTAGGAGATTAAAA 1 144 1 ATTAGGAGAT 0.995154 -15 ********** Masking position 3 Map Score: 6.33802 Number of sites scoring better than the average of aligned sites = 91 Number in coding regions = 77 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 2 ACGTTTTATCACTAAAATTAACAAAAAATA 1 42 1 ACTAAAATTA 0.980247 -117 ACTAAAATTAACAAAAAATAACATTTTTTA 1 52 1 ACAAAAAATA 0.990281 -107 TCACAGAATGATAAAAAATGTTATTTTTTG 1 63 0 ATAAAAAATG 0.919702 -96 ATTAGCCGATACAATAAATTAAATCTGAGA 1 99 0 ACAATAAATT 0.924313 -60 ATAGATCTTAACTAAATTTATCTGTATATT 1 126 0 ACTAAATTTA 0.937797 -33 ********** Masking position 6 Map Score: 3.80746 Number of sites scoring better than the average of aligned sites = 436 Number in coding regions = 356 Number in noncoding regions = 80 Number of orfs with sites within 600 bp upstream = 82 Fraction of orfs with sites within 600 bp upstream = 0.0131706 Motif number 3 AAAACGTTATGAGCTCATAATCTGATTTGA 1 19 0 GAGCTCATAA 0.989108 -140 AATTAAATCTGAGATCTAGATCACAGAATG 1 83 0 GAGATCTAGA 0.989108 -76 AATCTCCTAATAGATCTTAACTAAATTTAT 1 135 0 TAGATCTTAA 0.974972 -24 GATCTATTAGGAGATTAAAA 1 149 1 GAGATTAAAA 0.974979 -10 ********** Masking position 5 Map Score: 2.67835 Number of sites scoring better than the average of aligned sites = 40 Number in coding regions = 29 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 4 ********** No masking Map Score: 1.72962e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.72962e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.72962e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0