AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i341_weak2_hinf_reg_300.orf -a/home/amcguire/alignace/lib/ORF_hinf.txt -z/skink1/amcguire/genomes/hinf.fna -g0.38 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI1603 207 conserved hypothetical protein #2 HI1604 24 phosphate permease, putative #3 HI1605 65 conserved hypothetical protein Motif number 1 TTTTTTACCTTTCAAATTTTCTCGCTTTTAAAGC 1 6 1 TATTTTTTCG 0.965849 -202 TTCTCGCTTTTAAAGCGAAAAGTGTATTGAGTTACTTAT 1 29 1 TACGTGTTTG 0.969402 -179 ATAAACCTTTTTTCTTACAAATTTTTTTGAAAAATTTTA 1 113 1 TTTTTTTTTG 0.986031 -95 TTCGTGCGCATATTACCCGATTTTTGTTGATAGTTAAAA 1 147 0 TACTTTTTTG 0.997038 -61 AGTTTATTTCCTATGTTTTGTTGA 2 2 0 TACTTTTTTG 0.997041 -23 GCGGTTAAAATTAACCGCACTTTTTATTGAGATCAA 3 8 0 TTCTTTTTTG 0.99615 -58 TGCGGTTAATTTTAACCGCACTTTTGTTGTGATGTTTAA 3 28 1 TTCTTTTTTG 0.99615 -38 ** * **** *** Masking position 13 Map Score: 10.5159 Number of sites scoring better than the average of aligned sites = 83 Number in coding regions = 66 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 2 TTTTTTACCTTTCAAATTTTCTCGC 1 3 1 TTTTCTTTAA 0.993931 -205 CTCAATACACTTTTCGCTTTAAAAGCGAGAAAA 1 27 0 TTTTCTTTAA 0.972787 -181 AAGATAAACCTTTTTTCTTACAAATTTTTTTGA 1 110 1 TTTTCTTAAA 0.979626 -98 TTTTGAAAAATTTTAACTATCAACAAAAATCGG 1 137 1 TTTTCTATAA 0.966267 -71 CGCACGAATTTTTAACCCCTTAATTTGGAGTAA 1 178 1 TTTACCCTAA 0.946143 -30 TTTTTCCCCTTAAACATCACAACA 3 52 0 TTTTCCTTAA 0.992329 -14 **** **** ** Masking position 3 Map Score: 9.10153 Number of sites scoring better than the average of aligned sites = 137 Number in coding regions = 100 Number in noncoding regions = 37 Number of orfs with sites within 600 bp upstream = 38 Fraction of orfs with sites within 600 bp upstream = 0.00610344 Motif number 3 GTTACTTATCTTACCACACTAGGAAATATT 1 59 1 TTACCACACT 0.984921 -149 AATCGGGTAATATGCGCACGAATTTTTAAC 1 164 1 TATGCGCACG 0.979989 -44 CGGTTAAAATTAACCGCACTTTTTATTGAG 3 16 0 TAACCGCACT 0.998468 -50 CGGTTAATTTTAACCGCACTTTTGTTGTGA 3 30 1 TAACCGCACT 0.998468 -36 ********** Masking position 8 Map Score: 6.27593 Number of sites scoring better than the average of aligned sites = 1046 Number in coding regions = 659 Number in noncoding regions = 387 Number of orfs with sites within 600 bp upstream = 265 Fraction of orfs with sites within 600 bp upstream = 0.0425634 Motif number 4 GTAAGCAACTGGGTAATATTTCCTAGTGTG 1 73 0 GGGTAATATT 0.991771 -135 TAAGAAAAAAGGTTTATCTTCGACTAAGTA 1 100 0 GGTTTATCTT 0.9417 -108 TTTTGTTGATAGTTAAAATTTTTCAAAAAA 1 135 0 AGTTAAAATT 0.923151 -73 AACAAAAATCGGGTAATATGCGCACGAATT 1 158 1 GGGTAATATG 0.977811 -50 CAAATTAAGGGGTTAAAAATTCGTGCGCAT 1 175 0 GGTTAAAAAT 0.950534 -33 TAAAAAGTGCGGTTAATTTTAACCGCACTT 3 21 1 GGTTAATTTT 0.977869 -45 ********** Masking position 6 Map Score: 6.02672 Number of sites scoring better than the average of aligned sites = 243 Number in coding regions = 160 Number in noncoding regions = 83 Number of orfs with sites within 600 bp upstream = 67 Fraction of orfs with sites within 600 bp upstream = 0.0107613 Motif number 5 AGCGAGAAAATTTGAAAGGTAAAAAA 1 6 0 TTTGAAAGTA 0.981 -202 ATTTTCTCGCTTTTAAAGCGAAAAGTGTATT 1 26 1 TTTTAAAGGA 0.97518 -182 ATTTCCTAGTGTGGTAAGATAAGTAACTCAA 1 55 0 GTGGTAAGTA 0.893006 -153 TTCAAAAAAATTTGTAAGAAAAAAGGTTTAT 1 113 0 TTTGTAAGAA 0.894767 -95 CCCGATTTTTGTTGATAGTTAAAATTTTTCA 1 140 0 GTTGATAGTA 0.964447 -68 TAACCGCACTTTTTATTGAGATCAA 3 5 0 TTTTATTGGA 0.808195 -61 TTGTTGTGATGTTTAAGGGGAAAAA 3 51 1 GTTTAAGGGA 0.945531 -15 ******** ** Masking position 11 Map Score: 2.24807 Number of sites scoring better than the average of aligned sites = 363 Number in coding regions = 311 Number in noncoding regions = 52 Number of orfs with sites within 600 bp upstream = 49 Fraction of orfs with sites within 600 bp upstream = 0.00787022 Motif number 6 AGCGAGAAAATTTGAAAGGTAAAAAA 1 7 0 TTTGAAAGGT 0.979302 -201 ATTTCCTAGTGTGGTAAGATAAGTAACTCA 1 56 0 GTGGTAAGAT 0.964757 -152 TTCAAAAAAATTTGTAAGAAAAAAGGTTTA 1 114 0 TTTGTAAGAA 0.944308 -94 TACAAATTTTTTTGAAAAATTTTAACTATC 1 128 1 TTTGAAAAAT 0.93905 -80 CCCGATTTTTGTTGATAGTTAAAATTTTTC 1 141 0 GTTGATAGTT 0.912853 -67 ********** Masking position 7 Map Score: 0.2238 Number of sites scoring better than the average of aligned sites = 309 Number in coding regions = 274 Number in noncoding regions = 35 Number of orfs with sites within 600 bp upstream = 30 Fraction of orfs with sites within 600 bp upstream = 0.0048185 Motif number 7 ********** No masking Map Score: 3.07965e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 3.07965e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 3.07965e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0